TotalSeq™-D0007 anti-human CD274 (B7-H1, PD-L1) Antibody

Pricing & Availability
Clone
29E.2A3 (See other available formats)
Regulatory Status
RUO
Other Names
Programmed cell death ligand 1 (PD-L1), B7 homolog 1 (B7-H1)
Isotype
Mouse IgG2b, κ
Barcode Sequence
GTTGTCCGACAATAC
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
329753 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD274, also known as PD-L1 and B7-H1, is type I transmembrane glycoprotein that serves as a ligand for CD279 (PD-1). This interaction is believed to regulate the balance between the stimulatory and inhibitory signals needed for responses to microbes and maintenance of self-tolerance. CD274 is involved in the costimulation of T cell proliferation and IL-10 and IFN-γ production in an IL-2-dependent and CD279-independent manner. Conflicting data has shown that CD274 can inhibit T cell proliferation and cytokine production, and alternatively, enhance T cell activation. Other studies suggest that CD274 may signal bidirectionally, raising interesting implications for its expression in a wide variety of cell types, including T and B cells, antigen-presenting cells, and nonhematopoietic cells.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Full length human PD-L1
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone 29E.2A3 is reported to recognize an epitope on PD-L1 within the PD-L1-CD80 binding region5. Additional reported applications (for the relevant formats) include: blocking1-3 and immunohistochemical staining of acetone-fixed frozen sections1. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 329715, 329716, 329745 - 329748). 

It has been observed that clone 29E.2A3 is able to bind to Alexa Fluor® 700 antibody conjugates during multi-color immunofluorescent staining. This interaction can be resolved by sequentially staining with the 29E.2A3 antibody first and then followed by the Alexa Fluor® 700 conjugate of interest.

Clone 29E.2A3 does not work in Western blot applications7.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Brown J, et al. 2003. J. Immunol. 170:1257. (FC, IHC, Block)
  2. Radziewicz H, et al. 2007. J. Virol. 81:2545. (Block)
  3. Nakamoto N, et al. 2009. PLoS Pathog. 5:e1000313. (Block)
  4. Barsoum IB, et al. 2014. Cancer Res. 74:665. PubMed
  5. Haile, S et al. 2013. J. Immunol. 191:2829.
  6. RL M, et al. 2015. PNAS. 112:6506-6514. PubMed
  7. Mahoney KM, et al. 2015. Cancer Immunol. Res. 3:1308.
RRID
AB_2892397 (BioLegend Cat. No. 329753)

Antigen Details

Distribution

T cells, B cells, NK cells, monocytes/macrophages, granulocytes and dendritic cells

Function
CD274 is involved in the costimulatory signal, essential for T lymphocyte proliferation and production of IL-10 and IFN-γ, in an IL-2-dependent and a PD-1-CD1-independent manner. Its interaction with PD-1-CD1 inhibits T-cell proliferation and cytokine production.
Ligand/Receptor
PD-1 (PDCD1)
Cell Type
B cells, Dendritic cells, Fibroblasts, Granulocytes, Macrophages, Monocytes, NK cells, T cells
Biology Area
Cancer Biomarkers, Costimulatory Molecules, Immunology
Molecular Family
Adhesion Molecules, CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Sharpe A, et al. 2007. Nat. Immunol. 8:239.

Gene ID
29126 View all products for this Gene ID
UniProt
View information about CD274 on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD274 Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD274 (B7-H1, PD-L1) 29E.2A3 FC,IHC-P,Block
Biotin anti-human CD274 (B7-H1, PD-L1) 29E.2A3 FC
PE anti-human CD274 (B7-H1, PD-L1) 29E.2A3 FC
APC anti-human CD274 (B7-H1, PD-L1) 29E.2A3 FC
Brilliant Violet 421™ anti-human CD274 (B7-H1, PD-L1) 29E.2A3 FC
Ultra-LEAF™ Purified anti-human CD274 (B7-H1, PD-L1) 29E.2A3 FC,IHC,Block
PE/Cyanine7 anti-human CD274 (B7-H1, PD-L1) 29E.2A3 FC
Purified anti-human CD274 (B7-H1, PD-L1) (Maxpar® Ready) 29E.2A3 FC,CyTOF®
Brilliant Violet 711™ anti-human CD274 (B7-H1, PD-L1) 29E.2A3 FC
Brilliant Violet 605™ anti-human CD274 (B7-H1, PD-L1) 29E.2A3 FC
GoInVivo™ Purified anti-human CD274 (B7-H1, PD-L1) 29E.2A3 FC,IHC,Block
PE/Dazzle™ 594 anti-human CD274 (B7-H1, PD-L1) 29E.2A3 FC
Brilliant Violet 785™ anti-human CD274 (B7-H1, PD-L1) 29E.2A3 FC
Brilliant Violet 510™ anti-human CD274 (B7-H1, PD-L1) 29E.2A3 FC
PerCP/Cyanine5.5 anti-human CD274 (B7-H1, PD-L1) 29E.2A3 FC
Brilliant Violet 650™ anti-human CD274 (B7-H1, PD-L1) 29E.2A3 FC
Alexa Fluor® 594 anti-human CD274 (B7-H1, PD-L1) 29E.2A3 IHC-P
TotalSeq™-A0007 anti-human CD274 (B7-H1, PD-L1) 29E.2A3 PG
TotalSeq™-B0007 anti-human CD274 (B7-H1, PD-L1) 29E.2A3 PG
TotalSeq™-C0007 anti-human CD274 (B7-H1, PD-L1) 29E.2A3 PG
TotalSeq™-D0007 anti-human CD274 (B7-H1, PD-L1) 29E.2A3 PG
PE/Fire™ 810 anti-human CD274 (B7-H1, PD-L1) Antibody 29E.2A3 FC
PE/Cyanine5 anti-human CD274 (B7-H1, PD-L1) 29E.2A3 FC
Spark YG™ 570 anti-human CD274 (B7-H1, PD-L1) 29E.2A3 IHC-P,FC
Go To Top Version: 1    Revision Date: 05-24-2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account