TotalSeq™-D0176 anti-human CD39 antibody, CD39, A1

Clone: A1 (See other available formats)
Regulatory Status: RUO
Workshop: HCDM listed
Other Names: gp80, E-ATPDase, NTPDase-1, ecto-apyrase, Ec3.6.1.5
Isotype: Mouse IgG1, κ
Barcode Sequence: TTACCTGGTATCCGT
Ave. Rating: Submit a Review
Product Citations: publications

Cat #	Size	Price	Save
328243	10 µg	¥81,180

Description

Human CD39 is an integral membrane protein with two transmembrane domains. It exists as a homotetramer. Expression of CD39 is found on activated lymphocytes, a subset of T cells and B cells, and dendritic cells with weak staining on monocytes and granulocytes. CD39 and CD73 have been found on regulatory T cells, specifically the effector/memory like T cells. CD39 can hydrolyze both nucleoside triphosphates and diphosphates. CD39 is the dominant ecto nucleotidase of vascular and placental trophoblastic tissues and appears to modulate the functional expression of type 2 purinergic (P2) G protein coupled receptors (GPCRs). CD39 has intrinsic ecto-ATPase activity. Expression of CD39 is induced on T cells and increased on B cells as a late activation antigen.

Product Details

Technical data sheet

Product Details

Verified Reactivity

Human, Cynomolgus, Rhesus

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

PHA activated human lymphocytes

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA

Preparation

The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.

Concentration

0.5 mg/mL

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Application Notes

The A1 antibody binds to the human CD39 cell surface antigen and has been shown to block MHC independent target cell recognition by hapten-specific CTL. Additional reported applications (for the relevant formats) include: in vitro CD39 blockade³, immunofluorescence⁴, immunohistochemistry⁶, and spatial biology (IBEX)^7,8. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for blocking assays (contact our custom solutions team).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References (PubMed link indicates BioLegend citation)

Aversa GG, et al. 1988. Transplant. P. 20:4952.
Aversa GG, et al. 1989. Transplant. P. 21:34950.
Borsellino G, et al. 2007. Blood. 110:1225. (Block)
Stockl J, et al. 2001. J. Immunol. 167:2724. (IF)
Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21.
Lyck L, et al. 2008. J. Histochem. Cytochem. 56:201. (IHC)
Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed

RRID

AB_2892394 (BioLegend Cat. No. 328243)

Antigen Details

Distribution: Activated lymphocytes, and also on a subset of T cells, regulatory T cells, B cells, and dendritic cells.
Cell Type: B cells, Dendritic cells, Lymphocytes, T cells, Tregs
Biology Area: Immunology
Molecular Family: CD Molecules
Gene ID: 953 View all products for this Gene ID
UniProt: View information about CD39 on UniProt.org

Documentation

Reviews

Review This Product

Related Protocols

TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Products

Description	Clone	Applications

Related Pages & Pathways

Pathways

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD39 Reagents Request Custom Conjugation

Description	Clone	Applications
Brilliant Violet 510™ anti-human CD39	A1	FC
Brilliant Violet 421™ anti-human CD39	A1	FC,IHC-P
Purified anti-human CD39	A1	FC,IHC-P,Block
Biotin anti-human CD39	A1	FC
FITC anti-human CD39	A1	FC
PE anti-human CD39	A1	FC,SB
APC anti-human CD39	A1	FC
PE/Cyanine7 anti-human CD39	A1	FC
PerCP/Cyanine5.5 anti-human CD39	A1	FC
Purified anti-human CD39 (Maxpar® Ready)	A1	FC,CyTOF®,IHC-P
PE/Dazzle™ 594 anti-human CD39	A1	FC
APC/Cyanine7 anti-human CD39	A1	FC
Brilliant Violet 711™ anti-human CD39	A1	FC
APC/Fire™ 750 anti-human CD39	A1	FC
Alexa Fluor® 594 anti-human CD39	A1	IHC-P
TotalSeq™-A0176 anti-human CD39	A1	PG
Brilliant Violet 605™ anti-human CD39	A1	FC
TotalSeq™-C0176 anti-human CD39	A1	PG
Brilliant Violet 785™ anti-human CD39	A1	FC
TotalSeq™-B0176 anti-human CD39	A1	PG
TotalSeq™-D0176 anti-human CD39	A1	PG
PE/Fire™ 810 anti-human CD39 Antibody	A1	FC

Certificate of Analysis

Go To Top Version: 1 Revision Date: 05/25/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.