- Clone
- Ber-ACT8 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V A067
- Other Names
- Integrin alpha E (ITGAE)
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GACCTCATTGTGAAT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
CD103 is a type I transmembrane glycoprotein also known as αE integrin, integrin αIEL chain, and human mucosal lymphocyte antigen 1. It belongs to the integrin family and is primarily found on intestinal intraepithelial lymphocytes (IEL). CD103 is also expressed on a subpopulation of lamina propria T cells, epithelial dendritic cells, lamina propria-derived dendritic cells, and a small subset of peripheral lymphocytes. Treg cells express high level of CD103. Hairy cell leukemia has also been shown to express CD103. The expression of CD103 on lymphocytes can be induced upon activation and TGF-β stimulation. In association with integrin β7, CD103 is expressed as an αE/β7 heterodimer. Mature CD103 protein can be cleaved into 2 chains, a 150 kD (C-terminal) chain and a 25 kD (N-terminal) chain, which remain linked by disulfide bonds. CD103 binds to E-cadherin and mediates homing of lymphocytes to the intestinal epithelium.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Cynomolgus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- HTLV-1 induced human T cell line MAPS16
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: Western Blotting1, immunoprecipitation1, and immunohistochemical staining of frozen tissue sections1.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Kruschwitz M, et al. 1991. J. Clin. Pathol. 44:636. (WB, IP, IHC-F)
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- RRID
-
AB_2922567 (BioLegend Cat. No. 350241)
Antigen Details
- Structure
- Type I transmembrane glycoprotein, integrin family; can be cleaved into 150 kD and 25 kD chains; associated with β7 integrin
- Distribution
-
Majority of intestinal intraepithelial lymphocytes (IEL), subpopulation of lamina propria T cells, epithelial dendritic cells, small subset of peripheral lymphocytes, Treg cells; expressed on hairy cell leukemia
- Function
- Retention and activation of CD103+ lymphocytes in the intestinal epithelium, regulation of tissue-specific T cell homing
- Ligand/Receptor
- E-Cadherin
- Cell Targets
- Integrin β7
- Cell Type
- Dendritic cells, Lymphocytes, T cells, Tregs
- Biology Area
- Cell Biology, Immunology, Neuroscience, Synaptic Biology
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Parker CM, et al. 1992. P. Natl. Acad. Sci. USA 89:1924.
2. Kruschwitz M, et al. 1991. J. Clin. Pathol. 44:636.
3. Schon MP, et al. 1999. J. Immunol. 162:6641.
4. Shaw SK, et al. 1994. J. Biol. Chem. 269:6016. - Gene ID
- 3682 View all products for this Gene ID
- UniProt
- View information about CD103 on UniProt.org
Related FAQs
Other Formats
View All CD103 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD103 (Integrin αE)
-
FITC anti-human CD103 (Integrin αE)
PHA-stimulated (3 day) human peripheral blood mononuclear ce... PHA-stimulated (3 day) human peripheral blood lymphocytes st... -
PE anti-human CD103 (Integrin αE)
PHA-stimulated (3 day) human peripheral blood lymphocytes st... -
Alexa Fluor® 488 anti-human CD103 (Integrin αE)
PHA-stimulated (3 day) human peripheral blood lymphocytes st... Human peripheral blood lymphocytes stained with mouse IgG1, ... -
Alexa Fluor® 647 anti-human CD103 (Integrin αE)
PHA-stimulated (3day) human peripheral blood mononuclear cel... Human peripheral blood mononuclear cells stained with mouse ... -
PE/Cyanine7 anti-human CD103 (Integrin αE)
-
Brilliant Violet 421™ anti-human CD103 (Integrin αE)
PHA-stimulated (3 days) human peripheral blood lymphocytes s... -
APC anti-human CD103 (Integrin αE)
PHA-stimulated (3 days) human peripheral blood lymphocytes w... -
Brilliant Violet 605™ anti-human CD103 (Integrin αE)
PHA-stimulated (3 days) human peripheral blood lymphocytes w... -
Biotin anti-human CD103 (Integrin αE)
PHA-stimulated (3 days) human peripheral blood lymphocytes w... -
Brilliant Violet 711™ anti-human CD103 (Integrin αE)
PHA-stimulated (3 days) human peripheral blood lymphocytes w... -
PE/Dazzle™ 594 anti-human CD103 (Integrin αE)
PHA-stimulated (3day) human peripheral blood mononuclear cel... -
PerCP/Cyanine5.5 anti-human CD103 (Integrin αE)
PHA-stimulated (3 day) human peripheral blood mononuclear ce... -
Brilliant Violet 785™ anti-human CD103 (Integrin αE)
PHA-stimulated (3 day) human peripheral blood lymphocytes st... -
APC/Cyanine7 anti-human CD103 (Integrin αE)
PHA-stimulated (3 day) human peripheral blood lymphocytes st... -
TotalSeq™-A0145 anti-human CD103 (Integrin αE)
-
TotalSeq™-C0145 anti-human CD103 (Integrin αE)
-
TotalSeq™-B0145 anti-human CD103 (Integrin αE)
-
APC/Fire™ 750 anti-human CD103 (Integrin αE)
PHA-stimulated (3 day) human peripheral blood lymphocytes we... -
PE/Fire™ 700 anti-human CD103 (Integrin αE) Antibody
PHA-stimulated (3 days) human peripheral blood lymphocytes s... -
TotalSeq™-D0145 anti-human CD103 (Integrin αE)
-
PE/Fire™ 640 anti-human CD103 (Integrin αE)
PHA-stimulated (3 days) human peripheral blood lymphocytes s... -
PE anti-human CD103
Typical result of PHA-stimulated (3 days) human peripheral b... -
FITC anti-human CD103
Typical results from PHA-stimulated (3 days) human periphera... -
APC anti-human CD103
Typical results from PHA-stimulated (3 days) human periphera... -
Spark YG™ 581 anti-human CD103 (Integrin αE)
PHA-stimulated (3 days) human peripheral blood mononuclear c... -
Spark NIR™ 685 anti-human CD103 (Integrin αE)
PHA-stimulated (3 days) human peripheral blood mononuclear c... -
Spark Blue™ 550 anti-human CD103 (Integrin αE)
PHA-stimulated (3 days) human peripheral blood mononuclear c... -
PE/Fire™ 810 anti-human CD103 (Integrin αE)
PHA-stimulated (3 days) human peripheral blood mononuclear c... -
GMP FITC anti-human CD103 (Integrin αE)
Typical result of PHA-stimulated (3 days) human peripheral b... -
GMP PE anti-human CD103 (Integrin αE)
Typical result of PHA-stimulated (3 days) human peripheral b... -
Spark Red™ 718 anti-human CD103 (Integrin αE) (Flexi-Fluor™)
-
Spark Blue™ 574 anti-human CD103 (Integrin αE) (Flexi-Fluor™)
-
PerCP/Fire™ 806 anti-human CD103 (Integrin, αE) Antibody
PHA-stimulated (3 days) human peripheral blood mononuclear c... PHA-stimulated (3 days) human peripheral blood mononuclear c... -
PerCP/Fire™ 780 anti-human CD103 (Integrin, αE)
PHA-stimulated (3 day) human peripheral blood mononuclear ce... PHA-stimulated (3 days) human peripheral blood mononuclear c...
Follow Us