TotalSeq™-D0597 anti-human CD209 (DC-SIGN) Antibody

Pricing & Availability
9E9A8 (See other available formats)
Regulatory Status
Other Names
Dendritic Cell-Specific Intercellular adhesion molecule 3 (ICAM-3)-Grabbing Nonintegrin
Mouse IgG2a, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
330123 10 µg 574€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD209, known as Dendritic Cell-Specific Intercellular adhesion molecule 3 (ICAM-3)-Grabbing Nonintegrin (DC-SIGN), is a 44 kD type II transmembrane glycoprotein and a member of the C-type lectin family. CD209 is expressed on myeloid dendritic cells, placental macrophages, liver and placental endothelial cells. CD209 binds to ICAM-3 (CD50), ICAM-2 (CD102), and Butyrophilin (BTN2A1), and mediates dendritic cell migration and T cell proliferation. Importantly, CD209 is a receptor of HIV-1 and some other viruses (such as West Nile virus, hepatitis C virus, etc), and some bacteria or parasites. It plays a criti­cal role in capturing and internalizing those pathogens. LSP1 (leukocyte-specific protein 1) interacts with the cytoplasmic domain of CD209 and mediates transport of HIV to the proteasome.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Antibody Type
Host Species
Extracellular domain of human DC-SIGN
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemistry on frozen tissue sections1 and spatial biology (IBEX)2,3.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Granelli-Piperno A, et al. 2005. J Immunol. 175:4265. (IHC-F)
  2. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  3. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
AB_2904349 (BioLegend Cat. No. 330123)

Antigen Details


Dendritic cells

Cell Type
Dendritic cells
Biology Area
Immunology, Innate Immunity
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Granelli-Piperno A, et al. 2005. J Immunol. 175:4265.

Gene ID
30835 View all products for this Gene ID
View information about CD209 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/15/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD209 (DC-SIGN)

  • FITC anti-human CD209 (DC-SIGN)

  • PE anti-human CD209 (DC-SIGN)

  • APC anti-human CD209 (DC-SIGN)

  • PerCP/Cyanine5.5 anti-human CD209 (DC-SIGN)

  • Alexa Fluor® 647 anti-human CD209 (DC-SIGN)

  • PE/Cyanine7 anti-human CD209 (DC-SIGN)

  • APC/Fire™ 750 anti-human CD209 (DC-SIGN)

  • Brilliant Violet 421™ anti-human CD209 (DC-SIGN)

  • TotalSeq™-A0597 anti-human CD209 (DC-SIGN)

  • TotalSeq™-C0597 anti-human CD209 (DC-SIGN)

  • TotalSeq™-B0597 anti-human CD209 (DC-SIGN)

  • TotalSeq™-D0597 anti-human CD209 (DC-SIGN)


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account