TotalSeq™-D0593 anti-human CD203c (E-NPP3) Antibody

Pricing & Availability
NP4D6 (See other available formats)
Regulatory Status
Other Names
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
324631 10 µg 574€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD203c, a transmembrane protein and a member of the ectoenzyme family, is involved in the hydrolysis of extracellular oligonucleotides, nucleoside phosphates, and NAD (possesses ATPase and ATP pyrophosphatase activity). The molecular weight of CD203c is between 130 and 150 kD under reducing conditions and 270 kD under non-reducing conditions. CD203c is expressed on basophils and mast cells, and is highly expressed on activated basophils. Secretory glands in endometrium and glioma cells are also positive. CD203c is a multifunctional ectoenzyme involved in the clearance of extracellular nucleotides whose substrates include nucleoside triphosphates, nucleoside diphosphates, cAMP, and NAD.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Antibody Type
Host Species
HEK-293 cells transfected with human E-NPP3
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Bühring HJ, et al. 1999. Blood 94:2343.
  2. Bühring HJ, et al. 2001. Blood 97:3303.
  3. Platz IJ, et al. 2001. Int. Arch. Allergy Immunol. 126:335.
  4. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
  5. Gernez Y, et al. 2011. Int. Arch. Allergy Immunol. 154:318. (FC) PubMed
AB_2904345 (BioLegend Cat. No. 324631)

Antigen Details

Transmembrane ectoenzyme family member involved in the hydrolysis of extracellular oligonucleotides, nucleoside phosphates, and NAD (possesses ATPase and ATP pyrophosphatase activity); reduced molecular weight is 130 and 150 kD, unreduced is 270 kD

Basophils and mast cells, highly expressed on activated basophils; secretory glands in endometrium and glioma cells are also positive

Multifunctional ectoenzyme involved in the clearance of extracellular nucleotides
Substrates include nucleoside triphosphates, nucleoside diphosphates, cAMP, and NAD
Cell Type
Basophils, Mast cells
Biology Area
Molecular Family
CD Molecules
Antigen References
  1. Yano Y, et al. 2003. Int. J. Mol. Med. 12:763-6.
  2. Andoh K, et al. 1999. Biochim. Biophys. Acta. 1446:213-24.
Gene ID
5169 View all products for this Gene ID
View information about CD203c on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/12/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD203c (E-NPP3)

  • PE anti-human CD203c (E-NPP3)

  • Brilliant Violet 510™ anti-human CD203c (E-NPP3)

  • Brilliant Violet 605™ anti-human CD203c (E-NPP3)

  • APC anti-human CD203c (E-NPP3)

  • PerCP/Cyanine5.5 anti-human CD203c (E-NPP3)

  • Brilliant Violet 421™ anti-human CD203c (E-NPP3)

  • FITC anti-human CD203c (E-NPP3)

  • PerCP anti-human CD203c (E-NPP3)

  • PE/Cyanine7 anti-human CD203c (E-NPP3)

  • PE/Dazzle™ 594 anti-human CD203c (E-NPP3)

  • Alexa Fluor® 647 anti-human CD203c (E-NPP3)

  • TotalSeq™-A0593 anti-human CD203c (E-NPP3)

  • TotalSeq™-C0593 anti-human CD203c (E-NPP3)

  • TotalSeq™-D0593 anti-human CD203c (E-NPP3)


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account