TotalSeq™-D0352 anti-human FcεRIα Antibody

Pricing & Availability
AER-37 (CRA-1) (See other available formats)
Regulatory Status
Other Names
FceRIa, FceRI-a, FceRI-alpha, FceRI alpha, high affinity IgE receptor
Mouse IgG2b, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
334651 10 µg 592€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

High affinity IgE receptor (FcεRI) plays a key role in IgE-mediated allergic immune response. FcεRI is a tetrameric receptor complex, which is composed of one α-subunit (FcεRIα), one β-subunit, and two γ-subunits. FcεRIα directly binds IgE with high affinity, while the β- and γ-chains are responsible for mediating intracellular signals. FcεRIα is a 50 kD transmembrane protein with Ig superfamily structure. It is primarily found on mast cells and basophils. Further studies have indicated that FcεRIα is also expressed on many inflammatory cells including cutaneuos Langerhans cells, dendritic cells, monocytes of patients with allergic disorders, platelets, bronchial epithelial cells, eosinophils produced in hypereosinophilic syndrome, and neutrophils from allergy-induced asthma patients.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Reported Reactivity
Baboon, Cynomolgus, Rhesus
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone AER-37 (CRA-1) has been reported to bind the receptor even in the presence of IgE.4

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Yamaguchi M, et al. 1999. J. Immunol. 162:5455.
  2. Suzukawa M, et al. 2005. Int. Immunol. 17:1249.
  3. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
  4. Yamaguchi M, et al. 1999. J. Immunol. 162:5455.
AB_2892406 (BioLegend Cat. No. 334651)

Antigen Details

Ig superfamily, 50 kD

Mast cells, basophils, cutaneuos Langerhans cells, dendritic cells, and monocytes from the patients with allergic disorders, platelets, bronchial epithelial cells, eosinophils from hypereosinophilic syndrome, neutrophils from allergic asthmatic patients

Bind IgE, trigger IgE-mediated allergic response
Cell Type
Basophils, Dendritic cells, Eosinophils, Langerhans cells, Mast cells, Monocytes, Neutrophils
Biology Area
Molecular Family
Fc Receptors
Antigen References

1. Riske F, et al. 1991. J. Biol. Chem. 266:11245
2. Gounni AS, et al. 2001. FASEB J. 15:940.
3. Maurer D, et al. 1996. J. Immunol. 157:607
4. Maurer d, et al. 1994. J. Exp. Med. 179:745
5. Campbell AM, et al. 1998. Am. J. Respir. Cell Mol. Biol. 19:92.

Gene ID
2205 View all products for this Gene ID
View information about FcepsilonRIalpha on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05/24/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human FcεRIα

  • Biotin anti-human FcεRIα

  • FITC anti-human FcεRIα

  • PE anti-human FcεRIα

  • Alexa Fluor® 647 anti-human FcεRIα

  • PerCP anti-human FcεRIα

  • APC anti-human FcεRIα

  • Pacific Blue™ anti-human FcεRIα

  • PE/Cyanine7 anti-human FcεRIα

  • PerCP/Cyanine5.5 anti-human FcεRIα

  • Brilliant Violet 421™ anti-human FcεRIα

  • Brilliant Violet 510™ anti-human FcεRIα

  • Direct-Blot™ HRP anti-human FcεRIα

  • Brilliant Violet 605™ anti-human FcεRIα

  • APC/Cyanine7 anti-human FcεRIα

  • Alexa Fluor® 700 anti-human FcεRIα

  • PE/Dazzle™ 594 anti-human FcεRIα

  • Brilliant Violet 711™ anti-human FcεRIα

  • Alexa Fluor® 488 anti-human FcεRIα

  • TotalSeq™-A0352 anti-human FcεRIα

  • TotalSeq™-C0352 anti-human FcεRIα

  • APC/Fire™ 750 anti-human FcεRIα

  • Ultra-LEAF™ Purified anti-human FcεRIα

  • TotalSeq™-B0352 anti-human FcεRIα

  • TotalSeq™-D0352 anti-human FcεRIα


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account