TotalSeq™-D0161 anti-human CD11b Antibody

Pricing & Availability
ICRF44 (See other available formats)
Regulatory Status
IV M047
Other Names
Integrin αM chain, C3biR, CR3, Mac-1, Mo1, ITGAM
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
301363 10 µg 574€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD11b is a 165-170 kD type I transmembrane glycoprotein also known as αM integrin, Mac-1, CR3, and C3biR. CD11b non-covalently associates with integrin β2 (CD18) and is expressed on granulocytes, monocytes/macrophages, dendritic cells, NK cells, and subsets of T and B cells. CD11b/CD18 is critical for the transendothelial migration of monocytes and neutrophils. It is also involved in granulocyte adhesion, phagocytosis, and neutrophil activation. CD11b/CD18 interacts with ICAM-1 (CD54), ICAM-2 (CD102), ICAM-4, CD14, CD23, heparin, iC3b, fibrinogen, and factor X.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon, Chimpanzee, Common Marmoset, Pig
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The ICRF44 antibody inhibits heterotypic adhesion of granulocytes in response to fMLP. Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections, immunofluorescence microscopy5, stimulation of monocytes3, blocking of heterotypic PMN aggregation8, and blocking of granulocyte activation12. This clone was tested in-house and does not work on formalin fixed paraffin-embedded (FFPE) tissue.

The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 301361 & 301362).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Knapp W. 1989. Leucocyte Typing IV. Oxford University Press New York.
  2. Barclay N, et al. 1997. The Leucocyte Antigen Facts Book. Academic Press Inc. San Diego.
  3. Rezzonico R, et al. 2001. Blood 97:2932. (Stim)
  4. Marsik C, et al. 2003. Shock 20:493. (FC)
  5. David A, et al. 2003. J. Leukoc. Biol. 74:551. (IF)
  6. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
  7. Thurlow LR, et al. 2010. Infect. Immun. 128:1128. (FC) PubMed
  8. Jadhav S, et al. 2001. J. Immunol. 167:5986. (Block)
  9. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  10. Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21. (FC)
  11. Wen T, et al. 2014. J Immunol. 192:5481. (FC) PubMed
  12. Sprong T, et al. 2003. Blood 102:3702. (Block)
  13. Cash JL, et al. 2013. EMBO Rep. 14:999. (FC) PubMed
  14. Larsson K, et al. 2015. PNAS. PubMed
AB_2892345 (BioLegend Cat. No. 301363)

Antigen Details

Integrin, type I transmembrane glycoprotein, associates with integrin β2 (CD18), 165-170 kD

Granulocytes, monocytes/macrophages, dendritic cells, NK cells, subset of T cells, subset of B cells

Adhesion, phagocytosis, chemotaxis, neutrophil activation
ICAM-1(CD54), ICAM-2 (CD102), ICAM-4, CD14, CD23, heparin, iC3b, fibrinogen, factor X
Cell Type
B cells, Dendritic cells, Granulocytes, Macrophages, Monocytes, Neutrophils, NK cells, T cells, Tregs
Biology Area
Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology, Innate Immunity, Neuroscience, Neuroscience Cell Markers
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Stewart M, et al. 1995. Curr Opin Cell Biol. 7:690.

Gene ID
3684 View all products for this Gene ID
View information about CD11b on

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD11b Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD11b ICRF44 FC
Biotin anti-human CD11b ICRF44 FC
PE anti-human CD11b ICRF44 FC
PE/Cyanine5 anti-human CD11b ICRF44 FC
Purified anti-human CD11b ICRF44 FC, CyTOF®, ICC, IHC
Pacific Blue™ anti-human CD11b ICRF44 FC
Alexa Fluor® 488 anti-human CD11b ICRF44 FC
Alexa Fluor® 647 anti-human CD11b ICRF44 FC
PE/Cyanine7 anti-human CD11b ICRF44 FC
PerCP/Cyanine5.5 anti-human CD11b ICRF44 FC
Brilliant Violet 421™ anti-human CD11b ICRF44 FC, ICC
Brilliant Violet 570™ anti-human CD11b ICRF44 FC
FITC anti-human CD11b ICRF44 FC
Brilliant Violet 605™ anti-human CD11b ICRF44 FC
Brilliant Violet 510™ anti-human CD11b ICRF44 FC, ICC
Brilliant Violet 650™ anti-human CD11b ICRF44 FC
Purified anti-human CD11b (Maxpar® Ready) ICRF44 FC, CyTOF®
Alexa Fluor® 594 anti-human CD11b ICRF44 ICC, FC
APC/Cyanine7 anti-human CD11b ICRF44 FC
Brilliant Violet 711™ anti-human CD11b ICRF44 FC
Brilliant Violet 785™ anti-human CD11b ICRF44 FC
PE/Dazzle™ 594 anti-human CD11b ICRF44 FC
APC/Fire™ 750 anti-human CD11b ICRF44 FC
APC anti-human CD11b ICRF44 FC
PE anti-human CD11b ICRF44 FC
TotalSeq™-A0161 anti-human CD11b ICRF44 PG
Alexa Fluor® 700 anti-human CD11b ICRF44 FC
PE/Cyanine7 anti-human CD11b ICRF44 FC
TotalSeq™-B0161 anti-human CD11b ICRF44 PG
TotalSeq™-C0161 anti-human CD11b ICRF44 PG
PerCP/Cyanine5.5 anti-human CD11b ICRF44 FC
Ultra-LEAF™ Purified anti-human CD11b ICRF44 FC, CyTOF®, Block, ICC, IHC
TotalSeq™-D0161 anti-human CD11b ICRF44 PG
GMP PE/Cyanine7 anti-human CD11b ICRF44 FC
Pacific Blue™ anti-human CD11b ICRF44 FC
GMP PE anti-human CD11b ICRF44 FC
Spark UV™ 387 anti-human CD11b ICRF44 FC
GMP PerCP/Cyanine5.5 anti-human CD11b ICRF44 FC
FITC anti-human CD11b ICRF44 FC
APC/Fire™ 750 anti-human CD11b ICRF44 FC
GMP APC anti-human CD11b ICRF44 FC
Go To Top Version: 1    Revision Date: 05/20/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC anti-human CD11b

  • Biotin anti-human CD11b

  • PE anti-human CD11b

  • PE/Cyanine5 anti-human CD11b

  • Purified anti-human CD11b

  • Pacific Blue™ anti-human CD11b

  • Alexa Fluor® 488 anti-human CD11b

  • Alexa Fluor® 647 anti-human CD11b

  • PE/Cyanine7 anti-human CD11b

  • PerCP/Cyanine5.5 anti-human CD11b

  • Brilliant Violet 421™ anti-human CD11b

  • Brilliant Violet 570™ anti-human CD11b

  • FITC anti-human CD11b

  • Brilliant Violet 605™ anti-human CD11b

  • Brilliant Violet 510™ anti-human CD11b

  • Brilliant Violet 650™ anti-human CD11b

  • Purified anti-human CD11b (Maxpar® Ready)

  • Alexa Fluor® 594 anti-human CD11b

  • APC/Cyanine7 anti-human CD11b

  • Brilliant Violet 711™ anti-human CD11b

  • Brilliant Violet 785™ anti-human CD11b

  • PE/Dazzle™ 594 anti-human CD11b

  • APC/Fire™ 750 anti-human CD11b

  • APC anti-human CD11b

  • PE anti-human CD11b

  • TotalSeq™-A0161 anti-human CD11b

  • Alexa Fluor® 700 anti-human CD11b

  • PE/Cyanine7 anti-human CD11b

  • TotalSeq™-B0161 anti-human CD11b

  • TotalSeq™-C0161 anti-human CD11b

  • PerCP/Cyanine5.5 anti-human CD11b

  • Ultra-LEAF™ Purified anti-human CD11b

  • TotalSeq™-D0161 anti-human CD11b

  • GMP PE/Cyanine7 anti-human CD11b

  • Pacific Blue™ anti-human CD11b

  • GMP PE anti-human CD11b

  • Spark UV™ 387 anti-human CD11b

  • GMP PerCP/Cyanine5.5 anti-human CD11b

  • FITC anti-human CD11b

  • APC/Fire™ 750 anti-human CD11b

  • GMP APC anti-human CD11b


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account