x and a member of the Ig-superfamily. It is expressed almost exclusively in eosinophils; however, basophils and mast cells can express it to a lower degree. Siglec-8 is a 54 kD transmembranal protein; the extracellular domain has one V-set Ig-'>

TotalSeq™-D0199 anti-human Siglec-8 Antibody

Pricing & Availability
7C9 (See other available formats)
Regulatory Status
Other Names
Sialic acid-binding Ig-like lectin 8 (Siglec-8), Siglec8L, Sialoadhesin family member 2 (SAF2)
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
347117 10 µg 287€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

Siglec-8 is a lectin specific for 6'-sulfo-sLex and a member of the Ig-superfamily. It is expressed almost exclusively in eosinophils; however, basophils and mast cells can express it to a lower degree. Siglec-8 is a 54 kD transmembranal protein; the extracellular domain has one V-set Ig-like domain and two C2-set domains. The cytoplasmic domain has two immunoreceptor tyrosine-based inhibitor motifs (ITIM) that recruit SH2-family phosphatases after tyrosine phosphorylation. There are reports that siglec-8 inhibits the release of histamine and prostaglandin D2 mediated by the IgEFcR. This molelcule is also involved in the induction of apoptosis.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Antibody Type
Host Species
Recombinant Siglec-8 fused to human IgG Fc
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Floyd H, et al. 2000. J. Biol. Chem. 275:861.
  2. Wen T, et al. 2014. J Immunol. 192:5481. PubMed
AB_2904369 (BioLegend Cat. No. 347117)

Antigen Details

A lectin of 54 kD, belonging to the Ig-superfamily; has one V-set Ig-like domain and two C2-set domains; has a single transmembrane domain, and two immunoreceptor tyrosine-based inhibitor motifs (ITIM) in the cytoplasmic domain

Eosinophils, basophils, mast cells

Cell adhesion, signal transduction
Phosphatases containing a SH2 domain
Inhibition of IgE receptor-triggered histamine and prostaglandin D2 release, apoptosis
Cell Type
Basophils, Eosinophils, Mast cells
Biology Area
Cell Adhesion, Cell Biology, Immunology, Signal Transduction
Molecular Family
Adhesion Molecules, Siglec Molecules
Antigen References

1. Bochner BS, et al. 2009. Clin. Exp. Allergy. 39:317.
2. Hudson SA, et al. 2009. J. Pharmacol. Exp. Ther. 330:608.
3. Nutku E, et al. 2005. Biochem. Biophys. Res. Commun. 336:918.

Gene ID
27181 View all products for this Gene ID
View information about Siglec-8 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/05/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human Siglec-8

  • PE anti-human Siglec-8

  • APC anti-human Siglec-8

  • PE/Dazzle™ 594 anti-human Siglec-8

  • PE/Cyanine7 anti-human Siglec-8

  • PerCP/Cyanine5.5 anti-human Siglec-8

  • TotalSeq™-C0199 anti-human Siglec-8

  • PE/Cyanine5 anti-human Siglec-8

  • TotalSeq™-D0199 anti-human Siglec-8

  • Biotin anti-human Siglec-8


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account