TotalSeq™-D0162 anti-human CD64 Antibody

Pricing & Availability
10.1 (See other available formats)
Regulatory Status
Other Names
FcγRI, FcR I
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
305051 10 µg 287€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD64 is a 72 kD single chain type I glycoprotein also known as FcγRI and FcR I. CD64 is a member of the immunoglobulin superfamily and is expressed on monocytes/macrophages, dendritic cells, and activated granulocytes. The expression can be upregulated by IFN-γ stimulation. CD64 binds IgG immune complex. It plays a role in antigen capture, phagocytosis of IgG/antigen complexes, and antibody-dependent cellular cytotoxicity (ADCC).

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
Baboon, Capuchin Monkey, Chimpanzee, Squirrel Monkey
Antibody Type
Host Species
Human rheumatoid synovial fluid cells and fibronectin-purified monocytes.
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone 10.1 recognizes the EC3 epitope of CD64. While both contain the EC3 domain, in-house testing suggests that clone 10.1 preferentially binds to CD64A (FcγRIA), but not CD64B (FcγRIB). Additional reported applications (for the relevant formats) include: blocking of human IgG3 and murine IgG2a binding to FcγRI2,5,6,11 and immunohistochemical staining of acetone-fixed frozen tissue sections12.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. McMichael A, et al. Eds. 1987. Leucocyte Typing III. Oxford University Press. New York.
  2. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York. p. 874.
  3. Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London.
  4. Holl V, et al. 2004. J. Immunol. 173:6274.
  5. Hober D, et al. 2002. J. Gen. Virol. 83:2169.
  6. Cho HJ, et al. 2007. Physiol Genomics 149:60.
  7. van Tits L, et al. 2005. Arterioscler Thromb Vasc Biol. 25:717. PubMed
  8. Bruhns P, et al. 2008. Blood 113:3716. PubMed
  9. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  10. Carter DL, et al. 1999. Cytometry 37:41. (FC)
  11. Dougherty GJ, et al. 1987. Eur. J. Immunol. 17:1453.
  12. Blom AB, et al. 2003. Arthritis Rheum. 48(4):1002-14. (IHC)
AB_2892360 (BioLegend Cat. No. 305051)

Antigen Details

Ig superfamily, type I glycoprotein, 72 kD

Monocytes, macrophages, dendritic cells, activated granulocytes

Phagocytosis, ADCC
IgG receptor
Cell Type
Dendritic cells, Granulocytes, Macrophages, Monocytes
Biology Area
Immunology, Innate Immunity
Molecular Family
CD Molecules, Fc Receptors
Antigen References

1. Hulett M, et al. 1994. Adv. Immunol. 57:1.
2. van de Winkel J, et al. 1993. Immunol. Today 14:215.

Gene ID
2209 View all products for this Gene ID
View information about CD64 on

Related FAQs

Is our human Trustain FcX™ (cat# 422302) compatible with anti human CD16, CD32 and CD64 clones 3G8, FUN-2 and 10.1 respectively?


Go To Top Version: 1    Revision Date: 05/24/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Biotin anti-human CD64

  • FITC anti-human CD64

  • PE anti-human CD64

  • Purified anti-human CD64

  • Alexa Fluor® 488 anti-human CD64

  • Alexa Fluor® 647 anti-human CD64

  • APC anti-human CD64

  • Pacific Blue™ anti-human CD64

  • Brilliant Violet 421™ anti-human CD64

  • PE/Cyanine7 anti-human CD64

  • PerCP/Cyanine5.5 anti-human CD64

  • APC/Cyanine7 anti-human CD64

  • Brilliant Violet 510™ anti-human CD64

  • Purified anti-human CD64 (Maxpar® Ready)

  • PE/Dazzle™ 594 anti-human CD64

  • Brilliant Violet 605™ anti-human CD64

  • APC/Fire™ 750 anti-human CD64

  • PE anti-human CD64

  • PE/Dazzle™ 594 anti-human CD64

  • FITC anti-human CD64

  • TotalSeq™-A0162 anti-human CD64

  • Brilliant Violet 711™ anti-human CD64

  • Alexa Fluor® 700 anti-human CD64

  • Brilliant Violet 785™ anti-human CD64

  • TotalSeq™-C0162 anti-human CD64

  • Ultra-LEAF™ Purified anti-human CD64

  • TotalSeq™-B0162 anti-human CD64

  • TotalSeq™-D0162 anti-human CD64

  • GMP PE anti-human CD64

  • GMP FITC anti-human CD64


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account