TotalSeq™-D0148 anti-human CD197 (CCR7) Antibody

Pricing & Availability
G043H7 (See other available formats)
Regulatory Status
Other Names
BLR2, CDw197, EBI1, CMKBR7
Mouse IgG2a, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
353267 10 µg 296€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CCR7, also known as CD197, is a chemokine receptor that binds CCL19 and CCL21. CCR7 and its ligands link innate and adaptive immunity by affecting interactions between T cells and dendritic cells and their downstream effect. Naïve T cells enter the lymph node through high endothelial venules, which express CCL21. Dendritic cells and macrophages enter the lymph node through afferent lymphatics. The encounter of T cells and dendritic cells in the T cell zone is CCR7-dependent. In addition, during immunological surveillance, B cells recirculate between B-cell-rich compartments (follicles or B cell zones) in secondary lymphoid organs, surveying for antigen. After antigen binding, B cells move to the boundary of B and T zones to interact with T-helper cells; this B cell migration is directed by CCR7 and its ligands. CCR7-positive cancer cell expression has been associated with lymph node metastasis.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Host Species
CCR7-transfected cells
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

AB_2894573 (BioLegend Cat. No. 353267)

Antigen Details

Chemokine receptor, G protein-coupled receptors (GPCR), seven transmembrane receptor.

T cells, B cells, NK, dendritic cells.

The chemokine receptor CCR7 plays a pivotal role in the homing of naïve T cells and regulatory T cells to secondary lymphoid organs, and the migration of dendritic cells into afferent lymphatic vessels.
CCL19 and CCL21.
Cell Type
B cells, Dendritic cells, NK cells, T cells
Biology Area
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors, GPCR
Antigen References

1. Yanagihara S, et al. 1998. J. Immunol. 161:3096.
2. Charo IF, et al. 2006. N. Engl. J. Med. 354:610.
3. Reif K, et al. 2002. Nature 416:94.
4. Nakata B, et al. 2008. Oncology 74:69.
5. Brodie T. et al. 2013. Cytometry A. 6: 530-2. PubMed
6. Graves A.J. et al. 2014. Cytometry A. 7: 576–9 PubMed
7. Moncunill G. et al. 2014. Cytometry A. 12: 995-8 PubMed

Gene ID
1236 View all products for this Gene ID
View information about CD197 on

Related FAQs

Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?

Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.

Other Formats

View All CD197 Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD197 (CCR7) G043H7 FC
Alexa Fluor® 488 anti-human CD197 (CCR7) G043H7 FC
Brilliant Violet 421™ anti-human CD197 (CCR7) G043H7 FC
PE anti-human CD197 (CCR7) G043H7 FC
APC/Cyanine7 anti-human CD197 (CCR7) G043H7 FC
Pacific Blue™ anti-human CD197 (CCR7) G043H7 FC
APC anti-human CD197 (CCR7) G043H7 FC
FITC anti-human CD197 (CCR7) G043H7 FC
Alexa Fluor® 647 anti-human CD197 (CCR7) G043H7 FC
PerCP/Cyanine5.5 anti-human CD197 (CCR7) G043H7 FC
Brilliant Violet 605™ anti-human CD197 (CCR7) G043H7 FC
PE/Cyanine7 anti-human CD197 (CCR7) G043H7 FC
Brilliant Violet 711™ anti-human CD197 (CCR7) G043H7 FC
Brilliant Violet 785™ anti-human CD197 (CCR7) G043H7 FC
Brilliant Violet 510™ anti-human CD197 (CCR7) G043H7 FC
Brilliant Violet 650™ anti-human CD197 (CCR7) G043H7 FC
PE/Dazzle™ 594 anti-human CD197 (CCR7) G043H7 FC
Biotin anti-human CD197 (CCR7) G043H7 FC
Purified anti-human CD197 (CCR7) (Maxpar® Ready) G043H7 FC, CyTOF®
PerCP anti-human CD197 (CCR7) G043H7 FC
Alexa Fluor® 700 anti-human CD197 (CCR7) G043H7 FC
APC/Fire™ 750 anti-human CD197 (CCR7) G043H7 FC
TotalSeq™-A0148 anti-human CD197 (CCR7) G043H7 PG
TotalSeq™-B0148 anti-human CD197 (CCR7) G043H7 PG
TotalSeq™-C0148 anti-human CD197 (CCR7) G043H7 PG
Brilliant Violet 750™ anti-human CD197 (CCR7) G043H7 FC
Ultra-LEAF™ Purified anti-human CD197 (CCR7) G043H7 FC, Block
Spark NIR™ 685 anti-human CD197 (CCR7) G043H7 FC
KIRAVIA Blue 520™ anti-human CD197 (CCR7) G043H7 FC
PE/Fire™ 640 anti-human CD197 (CCR7) G043H7 FC
Spark YG™ 581 anti-human CD197 (CCR7) G043H7 FC
APC/Fire™ 810 anti-human CD197 (CCR7) Antibody G043H7 FC
TotalSeq™-D0148 anti-human CD197 (CCR7) G043H7 PG
PE/Fire™ 810 anti-human CD197 (CCR7) Antibody G043H7 FC
PE/Cyanine5 anti-human CD197 (CCR7) G043H7 FC
Go To Top Version: 1    Revision Date: 05/26/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD197 (CCR7)

  • Alexa Fluor® 488 anti-human CD197 (CCR7)

  • Brilliant Violet 421™ anti-human CD197 (CCR7)

  • PE anti-human CD197 (CCR7)

  • APC/Cyanine7 anti-human CD197 (CCR7)

  • Pacific Blue™ anti-human CD197 (CCR7)

  • APC anti-human CD197 (CCR7)

  • FITC anti-human CD197 (CCR7)

  • Alexa Fluor® 647 anti-human CD197 (CCR7)

  • PerCP/Cyanine5.5 anti-human CD197 (CCR7)

  • Brilliant Violet 605™ anti-human CD197 (CCR7)

  • PE/Cyanine7 anti-human CD197 (CCR7)

  • Brilliant Violet 711™ anti-human CD197 (CCR7)

  • Brilliant Violet 785™ anti-human CD197 (CCR7)

  • Brilliant Violet 510™ anti-human CD197 (CCR7)

  • Brilliant Violet 650™ anti-human CD197 (CCR7)

  • PE/Dazzle™ 594 anti-human CD197 (CCR7)

  • Biotin anti-human CD197 (CCR7)

  • Purified anti-human CD197 (CCR7) (Maxpar® Ready)

  • PerCP anti-human CD197 (CCR7)

  • Alexa Fluor® 700 anti-human CD197 (CCR7)

  • APC/Fire™ 750 anti-human CD197 (CCR7)

  • TotalSeq™-A0148 anti-human CD197 (CCR7)

  • TotalSeq™-B0148 anti-human CD197 (CCR7)

  • TotalSeq™-C0148 anti-human CD197 (CCR7)

  • Brilliant Violet 750™ anti-human CD197 (CCR7)

  • Ultra-LEAF™ Purified anti-human CD197 (CCR7)

  • Spark NIR™ 685 anti-human CD197 (CCR7)

  • KIRAVIA Blue 520™ anti-human CD197 (CCR7)

  • PE/Fire™ 640 anti-human CD197 (CCR7)

  • Spark YG™ 581 anti-human CD197 (CCR7)

  • APC/Fire™ 810 anti-human CD197 (CCR7) Antibody

  • TotalSeq™-D0148 anti-human CD197 (CCR7)

  • PE/Fire™ 810 anti-human CD197 (CCR7) Antibody

  • PE/Cyanine5 anti-human CD197 (CCR7)


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account