TotalSeq™-D0048 anti-human CD45 Antibody

Pricing & Availability
2D1 (See other available formats)
Regulatory Status
Other Names
Leukocyte Common Antigen (LCA), T200
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
368553 10 µg 287€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD45 is a 180 - 240 kD single chain type I membrane glycoprotein also known as leukocyte common antigen (LCA) and T200. It is a tyrosine phosphatase expressed on the plasma membrane of all hematopoietic cells, except erythrocytes or platelets. CD45 is a signaling molecule that regulates a variety of cellular processes including cell growth, differentiation, cell cycle, and oncogenic transformation. CD45 plays a critical role in T and B cell antigen receptor-mediated activation by dephosphorylating substrates including p56Lck, p59Fyn, and other Src family kinases. CD45 non-covalently associates with lymphocyte phosphatase-associated phosphoprotein (LPAP) on T and B lymphocytes. CD45 has been reported to bind galectin-1 and to be associated with several other cell surface antigens including CD1, CD2, CD3, and CD4.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Antibody Type
Host Species
Human PBMC
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

It was found that the HI30 clone and the 2D1 clone can cross block each other's binding.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Bradstock KF, et al. 1980. J. Natl. Cancer Inst. 65:33.
  2. Csiba A, et al. 1984. Br. J. Cancer 50:699.
  3. Tchilian EZ, et al. 2001. J. Immunol. 166:1308.
  4. Lee MS, et al. 2004. Int. Immunol. 16:1109.
AB_2894610 (BioLegend Cat. No. 368553)

Antigen Details

Type I transmembrane protein, 180 - 240 kD (multiple isoforms)

Hematopoietic cells, except circulating erythrocytes or platelets.

Tyrosine phosphatases, signaling, co-stimulation (co-inhibition), TCR and BCR mediated activation.
Galectin-1, CD2, CD3, and CD4.
Cell Type
B cells, Dendritic cells, Neutrophils
Biology Area
Cell Biology, Immunology, Inhibitory Molecules, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules, Protein Kinases/Phosphatase, TCRs
Antigen References

1. Thomas M. 1989. Annu. Rev. Immunol. 7:339.
2. Trowbridge I, et al. 1994. Annu. Rev. Immunol. 12:85.

Gene ID
5788 View all products for this Gene ID
View information about CD45 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 08/05/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD45

  • PerCP anti-human CD45

  • FITC anti-human CD45

  • PE anti-human CD45

  • APC anti-human CD45

  • Alexa Fluor® 700 anti-human CD45

  • APC/Cyanine7 anti-human CD45

  • PerCP/Cyanine5.5 anti-human CD45

  • APC/Fire™ 750 anti-human CD45

  • Alexa Fluor® 594 anti-human CD45

  • Brilliant Violet 510™ anti-human CD45

  • Brilliant Violet 421™ anti-human CD45

  • PE/Dazzle™ 594 anti-human CD45

  • Brilliant Violet 605™ anti-human CD45

  • PE/Cyanine7 anti-human CD45

  • Pacific Blue™ anti-human CD45

  • Alexa Fluor® 647 anti-human CD45

  • Biotin anti-human CD45

  • Alexa Fluor® 488 anti-human CD45

  • TotalSeq™-A0048 anti-human CD45

  • Brilliant Violet 750™ anti-human CD45

  • TotalSeq™-C0048 anti-human CD45

  • TotalSeq™-B0048 anti-human CD45

  • Spark Blue™ 550 anti-human CD45

  • Spark NIR™ 685 anti-human CD45

  • TotalSeq™-D0048 anti-human CD45

  • PE/Cyanine5 anti-human CD45

  • Spark Blue™ 574 anti-human CD45 Antibody


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account