TotalSeq™-D0034 anti-human CD3 Antibody

Pricing & Availability
UCHT1 (See other available formats)
Regulatory Status
III 471
Other Names
T3, CD3ε
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
300485 10 µg 296€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD3ε is a 20 kD chain of the CD3/T-cell receptor (TCR) complex which is composed of two CD3ε, one CD3γ, one CD3δ, one CD3ζ (CD247), and a T-cell receptor (α/β or γ/δ) heterodimer. It is found on all mature T cells, NKT cells, and some thymocytes. CD3, also known as T3, is a member of the immunoglobulin superfamily that plays a role in antigen recognition, signal transduction, and T cell activation.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Reported Reactivity
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections4,6,7 and formalin-fixed paraffin-embedded sections11, immunoprecipitation1, activation of T cells2,3,5, Western blotting9, and spatial biology (IBEX)16,17. The LEAF™ purified antibody (Endotoxin < 0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 300413, 300414, and 300432). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 300437, 300438, 300465, 300466, 300473, 300474) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin < 0.01 EU/µg).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Salmeron A, et al. 1991. J. Immunol. 147:3047. (IP)
  2. Graves J, et al. 1991. J. Immunol. 146:2102. (Activ)
  3. Lafont V, et al. 2000. J. Biol. Chem. 275:19282. (Activ)
  4. Ryschich E, et al. 2003. Tissue Antigens 62:48. (IHC)
  5. Thompson AG, et al. 2004. J. Immunol. 173:1671. (Activ)
  6. Sakkas LI, et al. 1998. Clin. Diagn. Lab. Immun. 5:430. (IHC)
  7. Mack CL, et al. 2004. Pediatr. Res. 56:79. (IHC)
  8. Thakral D, et al. 2008. J. Immunol. 180:7431. (FC) PubMed
  9. Van Dongen JJM, et al. 1988. Blood 71:603. (WB)
  10. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  11. Pollard, K. et al. 1987. J. Histochem. Cytochem. 35:1329. (IHC)
  12. Luckashenak N, et al. 2013. J. Immunol. 190:27. PubMed
  13. Laurent AJ, et al. 2014. PLoS One. 9:103683. PubMed
  14. Li J, et al. 2015. Cancer Res. 75:508. PubMed
  15. Stoeckius M, et al. 2017. Nat. Methods. 14:865-868. (PG)
  16. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  17. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
AB_2892342 (BioLegend Cat. No. 300485)

Antigen Details

Ig superfamily, with the subunits of CD3γ, CD3δ, CD3ζ (CD247) and TCR (α/β or γ/δ) forms CD3/TCR complex, 20 kD

Mature T and NK T cells, thymocyte differentiation

Antigen recognition, signal transduction, T cell activation
Peptide antigen bound to MHC
Cell Type
NKT cells, T cells, Thymocytes, Tregs
Biology Area
Immunology, Innate Immunity
Molecular Family
CD Molecules, TCRs
Antigen References

1. Barclay N, et al. 1993. The Leucocyte FactsBook. Academic Press. San Diego.
2. Beverly P, et al. 1981. Eur. J. Immunol. 11:329.
3. Lanier L, et al. 1986. J. Immunol. 137:2501-2507.

Gene ID
916 View all products for this Gene ID
View information about CD3 on

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD3 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD3 UCHT1 FC
Biotin anti-human CD3 UCHT1 FC
FITC anti-human CD3 UCHT1 FC
PE anti-human CD3 UCHT1 FC
PE/Cyanine5 anti-human CD3 UCHT1 FC
Purified anti-human CD3 UCHT1 FC, CyTOF®, IHC-F, IP, Activ, WB
Alexa Fluor® 647 anti-human CD3 UCHT1 FC, ICC, IHC-F
Alexa Fluor® 488 anti-human CD3 UCHT1 FC, ICC, IHC-F
Pacific Blue™ anti-human CD3 UCHT1 FC
PE/Cyanine7 anti-human CD3 UCHT1 FC
Alexa Fluor® 700 anti-human CD3 UCHT1 FC
APC/Cyanine7 anti-human CD3 UCHT1 FC
PerCP anti-human CD3 UCHT1 FC
PerCP/Cyanine5.5 anti-human CD3 UCHT1 FC
Brilliant Violet 421™ anti-human CD3 UCHT1 FC, ICC, IHC-F
Brilliant Violet 570™ anti-human CD3 UCHT1 FC
Ultra-LEAF™ Purified anti-human CD3 UCHT1 FC, CyTOF®, IHC-F, IP, Activ, WB
Purified anti-human CD3 (Maxpar® Ready) UCHT1 FC, CyTOF®
Alexa Fluor® 594 anti-human CD3 UCHT1 ICC, FC, SB
PE/Dazzle™ 594 anti-human CD3 UCHT1 FC
Brilliant Violet 510™ anti-human CD3 UCHT1 FC
Brilliant Violet 605™ anti-human CD3 UCHT1 FC
Brilliant Violet 711™ anti-human CD3 UCHT1 FC
Brilliant Violet 650™ anti-human CD3 UCHT1 FC
APC/Fire™ 750 anti-human CD3 UCHT1 FC
Pacific Blue™ anti-human CD3 UCHT1 FC
Brilliant Violet 785™ anti-human CD3 UCHT1 FC
PE/Dazzle™ 594 anti-human CD3 UCHT1 FC
TotalSeq™-A0034 anti-human CD3 UCHT1 PG
TotalSeq™-B0034 anti-human CD3 UCHT1 PG
TotalSeq™-C0034 anti-human CD3 UCHT1 PG
PE anti-human CD3 UCHT1 FC
PE/Cyanine7 anti-human CD3 UCHT1 FC
KIRAVIA Blue 520™ anti-human CD3 UCHT1 FC
Spark Violet™ 538 anti-human CD3 Antibody UCHT1 FC
TotalSeq™-D0034 anti-human CD3 UCHT1 PG
Spark Blue™ 574 anti-human CD3 Antibody UCHT1 FC
GMP Pacific Blue™ anti-human CD3 UCHT1 FC
GMP PE anti-human CD3 UCHT1 FC
GMP PE/Dazzle™ 594 anti-human CD3 UCHT1 FC
Go To Top Version: 1    Revision Date: 05/24/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC anti-human CD3

  • Biotin anti-human CD3

  • FITC anti-human CD3

  • PE anti-human CD3

  • PE/Cyanine5 anti-human CD3

  • Purified anti-human CD3

  • Alexa Fluor® 647 anti-human CD3

  • Alexa Fluor® 488 anti-human CD3

  • Pacific Blue™ anti-human CD3

  • PE/Cyanine7 anti-human CD3

  • Alexa Fluor® 700 anti-human CD3

  • APC/Cyanine7 anti-human CD3

  • PerCP anti-human CD3

  • PerCP/Cyanine5.5 anti-human CD3

  • Brilliant Violet 421™ anti-human CD3

  • Brilliant Violet 570™ anti-human CD3

  • Ultra-LEAF™ Purified anti-human CD3

  • Purified anti-human CD3 (Maxpar® Ready)

  • Alexa Fluor® 594 anti-human CD3

  • PE/Dazzle™ 594 anti-human CD3

  • Brilliant Violet 510™ anti-human CD3

  • Brilliant Violet 605™ anti-human CD3

  • Brilliant Violet 711™ anti-human CD3

  • Brilliant Violet 650™ anti-human CD3

  • APC/Fire™ 750 anti-human CD3

  • Pacific Blue™ anti-human CD3

  • Brilliant Violet 785™ anti-human CD3

  • PE/Dazzle™ 594 anti-human CD3

  • TotalSeq™-A0034 anti-human CD3

  • TotalSeq™-B0034 anti-human CD3

  • TotalSeq™-C0034 anti-human CD3

  • PE anti-human CD3

  • PE/Cyanine7 anti-human CD3

  • KIRAVIA Blue 520™ anti-human CD3

  • Spark Violet™ 538 anti-human CD3 Antibody

  • TotalSeq™-D0034 anti-human CD3

  • Spark Blue™ 574 anti-human CD3 Antibody

  • GMP Pacific Blue™ anti-human CD3

  • GMP PE anti-human CD3

  • GMP PE/Dazzle™ 594 anti-human CD3


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account