TotalSeq™-D0160 anti-human CD1c Antibody

Pricing & Availability
Clone
L161 (See other available formats)
Regulatory Status
RUO
Workshop
V T-CD01.18
Other Names
R7, M241, BDCA-1
Isotype
Mouse IgG1, κ
Barcode Sequence
GAGCTACTTCACTCG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
331551 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD1c, also known as R7 or M241, is a 43 kD member of the five CD1 antigens (CD1a-e) in humans. The CD1 molecules are type I glycoprotein with structural similarities to MHC class I and are non-covalently associated with β2-microglobulin, belonging to the Ig superfamily. CD1c is expressed on cortical thymocytes, Langerhans cells, dendritic cells, and a subset of B cells. It has been reported that CD1c is also expressed on mature T cells in a tightly regulated manner. CD1c is involved in antigen-presentation of glycolipids. It may also act in T cells as an immune regulatory molecule.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining on frozen tissue4, 5, formalin-fixed paraffin-embedded immunohistochemical staining6, and spatial biology (IBEX)7,8.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. del C Salamone M, et al. 2001. J Leukoc Biol. 70:567.
  2. de Fraissinette A, et al. 1988. Exp Hematol. 16:764.
  3. Li D, et al. 2012. J Exp Med. 209:109. PubMed
  4. Xu C, et al. 2010. Am J Hematol. 85:539 (IHC-F)
  5. Gerlini G, et al. 2001. J Invest Dermatol. 117:576 (IHC-F)
  6. Poposki J, et al. 2016. Clin Exp Allergy 45:384 (IHC-P) PubMed
  7. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  8. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID
AB_2892400 (BioLegend Cat. No. 331551)

Antigen Details

Structure
43 kD, Ig superfamily, MHC I-like molecule, associates with β2-microglobulin
Distribution

B cell subset, cortical thymocytes, dendritic cells, and Langerhans cells

Function
Presents lipid antigen to CD1c-restricted T cells
Ligand/Receptor
CD1c-restricted TCR
Cell Type
B cells, Dendritic cells, Langerhans cells, Thymocytes
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Fainboim LM and del C. Salamone. 2002. J. Biol. Reg. Homeos. Ag. 16:125.
2. M. del Salamone C, et al. 2001. J. Leukocyte Biol. 70:567.
3. Zola H, et al. Eds. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. P42.

Gene ID
911 View all products for this Gene ID
UniProt
View information about CD1c on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05/24/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • PerCP anti-human CD1c

  • Purified anti-human CD1c

  • Biotin anti-human CD1c

  • PE anti-human CD1c

  • Pacific Blue™ anti-human CD1c

  • Alexa Fluor® 647 anti-human CD1c

  • PerCP/Cyanine5.5 anti-human CD1c

  • Brilliant Violet 421™ anti-human CD1c

  • PE/Cyanine7 anti-human CD1c

  • FITC anti-human CD1c

  • APC/Cyanine7 anti-human CD1c

  • APC anti-human CD1c

  • Alexa Fluor® 488 anti-human CD1c

  • Alexa Fluor® 700 anti-human CD1c

  • PE/Dazzle™ 594 anti-human CD1c

  • Brilliant Violet 510™ anti-human CD1c

  • Brilliant Violet 605™ anti-human CD1c

  • Brilliant Violet 711™ anti-human CD1c

  • TotalSeq™-A0160 anti-human CD1c

  • Brilliant Violet 650™ anti-human CD1c

  • Brilliant Violet 785™ anti-human CD1c

  • APC/Fire™ 750 anti-human CD1c

  • TotalSeq™-C0160 anti-human CD1c

  • TotalSeq™-B0160 anti-human CD1c

  • TotalSeq™-D0160 anti-human CD1c

  • PE/Cyanine5 anti-human CD1c

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account