- Clone
- BNI3 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- CTLA4, Cytotoxic T-Lymphocyte Antigen 4, CTLA-4
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- ATGGTTCACGTAATC
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
369635 | 10 µg | 296€ |
CD152, also known as Cytotoxic T-Lymphocyte Antigen 4 (CTLA-4), is a 33 kD member of the immunoglobulin superfamily. It is transiently expressed on activated T cells. CTLA-4 is expressed on the surface of helper T cells and transmits an inhibitory signal to T cells. Regulatory T cells express high levels of CTLA-4. CTLA-4 (CD152) is similar to CD28 in amino acid sequence, structure, and genomic organization. Whereas CD28 delivers a costimulatory signal in T cell activation, CTLA-4 negatively regulates cell-mediated immune responses through interaction with CD80 (B7-1) and CD86 (B7-2) present on antigen presenting cells (APC). CTLA-4 is thought to play a role in the induction and maintenance of immunological tolerance as well as the development of protective immunity and thymocyte regulation.
Mutations in the CTLA-4 gene have been associated with various autoimmune diseases, such as systemic lupus erythematosus, insulin-dependent diabetes mellitus, and other autoimmune diseases. A transcript of the CTLA-4 gene that may represent a native soluble form of CTLA-4 (sCTLA-4) showed that eleven of twenty patients with autoimmune thyroid disease (ATD) had a high concentration of sCTLA-4, whereas only 1 of 30 apparently healthy volunteers contained measurable levels. sCTLA-4 immunoreactivity was inhibited by its binding to B7.1, suggesting that sCTLA-4 is a functional receptor. sCTLA-4 also plays a role in the initial immune response to infection of immune cells by HIV, along with the CD-1 pathway and others.
Product Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Extracellular domain of human CTLA-4 and constant regions of the human IgG heavy chain (CTLA-4/IgG)
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Based on in-house testing, we do not recommend using clone BNI3 for immunohistochemistry of paraffin-embedded tissue section.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Linsley PS, et al. 1992. J. Exp. Med. 176:1595.
- Bonzheim I, et al. 2008. Am. J. Clin. Pathol. 130:613.
- RRID
-
AB_2894575 (BioLegend Cat. No. 369635)
Antigen Details
- Structure
- Ig superfamily and 33 kD.
- Distribution
-
Activated T cells and B cells.
- Function
- Negative regulator of T cell activation.
- Interaction
- Antigen presenting cells, such as dendritic cells.
- Ligand/Receptor
- B7-1 (CD80), B7-2 (CD86).
- Cell Type
- B cells, T cells
- Biology Area
- Immunology, Inhibitory Molecules
- Molecular Family
- CD Molecules, Immune Checkpoint Receptors
- Antigen References
-
1. Kuiper HM, et al. 1995. J. Immunol. 155:1776.
2. Castan J, et al. 1997. Immunology 90:265.
3. Lee CC, et al. 2009. Pediatr. Allergy Immunol. 20:624.
4. Pistillo MP, et al. 2003. Blood 101:202.
5. Tan PH, et al. 2005. Blood. 106:2936.
6. Steiner K, et al. 2001. Clin. Exp. Immunol. 126:143. - Gene ID
- 1493 View all products for this Gene ID
- UniProt
- View information about CD152 on UniProt.org
Related FAQs
Other Formats
View All CD152 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD152 (CTLA-4)
-
PE anti-human CD152 (CTLA-4)
-
Brilliant Violet 421™ anti-human CD152 (CTLA-4)
-
Brilliant Violet 605™ anti-human CD152 (CTLA-4)
-
PerCP/Cyanine5.5 anti-human CD152 (CTLA-4)
-
Biotin anti-human CD152 (CTLA-4)
-
APC anti-human CD152 (CTLA-4)
-
PE/Cyanine7 anti-human CD152 (CTLA-4)
-
PE/Dazzle™ 594 anti-human CD152 (CTLA-4)
-
TotalSeq™-A0151 anti-human CD152 (CTLA-4)
-
TotalSeq™-C0151 anti-human CD152 (CTLA-4)
-
Brilliant Violet 785™ anti-human CD152 (CTLA-4)
-
TotalSeq™-B0151 anti-human CD152 (CTLA-4)
-
APC/Fire™ 750 anti-human CD152 (CTLA-4)
-
Alexa Fluor® 647 anti-human CD152 (CTLA-4)
-
APC/Cyanine7 anti-human CD152 (CTLA-4) Antibody
-
Brilliant Violet™ 711 anti-human CD152 (CTLA-4)
-
TotalSeq™-D0151 anti-human CD152 (CTLA-4)
-
PE/Fire™ 640 anti-human CD152 (CTLA-4)
-
Spark Red™ 718 anti-human CD152 (CTLA-4)
-
PE/Cyanine5 anti-human CD152 (CTLA-4)
Follow Us