TotalSeq™-D0141 anti-human CD195 (CCR5) Antibody

Pricing & Availability
Clone
J418F1 (See other available formats)
Regulatory Status
RUO
Other Names
C-C chemokine receptor type 5 (CCR5), HIV-1 fusion co-receptor
Isotype
Rat IgG2b, κ
Barcode Sequence
CCAAAGTAAGAGCCA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
359141 10 µg 260,00€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD195, also known as CCR5, is a 45 kD G protein-coupled seven transmembrane CC-chemokine receptor. It binds to MIP-1α, MIP-1β, and RANTES and is expressed on a subset of T cells and monocytes. CCR5 mediates an intracellular signal thought to induce cell differentiation and proliferation. CCR5 has also been shown to act as a co-receptor for R5 HIV-1 cell entry; modification of CCR5 by sulfation contributes to the efficiency of HIV-1 entry. Studies have shown CCR5 to play a role in a variety of other human diseases, ranging from infectious and inflammatory diseases to cancer.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Human
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Human CCR5 transfectants
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID
AB_2894570 (BioLegend Cat. No. 359141)

Antigen Details

Structure
G-coupled receptor family 1, membrane protein, 45 kD
Distribution

Subset of T cells, monocytes

Function
Binds C-C chemokines and transduces an intracellular signal thought to result in proliferation and differentiation, acts as a co-receptor with CD4 for HIV-1
Ligand/Receptor
MIP-1α, MIP-1β, RANTES
Cell Type
Monocytes, T cells
Biology Area
Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors, GPCR
Antigen References

1. Samson M, et al. 1996. Biochemistry 35:3362.
2. Raport CJ, et al. 1996. J. Biol. Chem. 271:17161.
3. Combadiere C, et al. 1996. J. Leukoc. Biol. 60:147.
4. Deng H, et al. 1996. Nature 381:661.
5. Lai J, et al. 2003. CVI. 10:1123.
6. Mañes S, et al. 2003. J. Exp. Med. 198:1381.
7. Vaday GG, et al. 2006. Prostate 66:124.

Gene ID
1234 View all products for this Gene ID
UniProt
View information about CD195 on UniProt.org

Related FAQs

Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?

Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.

Go To Top Version: 1    Revision Date: 08/12/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Insert Note Here
Save Close Clear
Lab Timer
Tools
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account