TotalSeq™-D0046 anti-human CD8 Antibody

Pricing & Availability
Clone
SK1 (See other available formats)
Regulatory Status
RUO
Other Names
T8, Leu2
Isotype
Mouse IgG1, κ
Barcode Sequence
GCGCAACTTGATGAT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
344767 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD8a is a 32-34 kD type I glycoprotein. It forms a homodimer (CD8a/a) or heterodimer (CD8a/b) with CD8b. CD8, also known as T8 and Leu2, is a member of the immunoglobulin superfamily found on the majority of thymocytes, a subset of peripheral blood T cells, and NK cells (which express almost exclusively CD8a homodimers). CD8 acts as a co-receptor with MHC class I-restricted T cell receptors in antigen recognition and T cell activation and has been shown to play a role in thymic differentiation. Two domains in CD8a are important for function: the extracellular IgSF domain binds the α3 domain of MHC class I and the cytoplasmic CXCP motif binds the tyrosine kinase p56 Lck.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Chimpanzee, Pigtailed Macaque, Sooty Mangabey
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone SK1 recognizes the a chain of CD8. Additional reported applications (for the relevant formats) include: proteogenomics8, immunohistochemistry of acetone-fixed frozen tissue sections, and spatial biology (IBEX)9,10. This clone was tested in-house and does not demonstrate utility for formalin-fixed paraffin-embedded (FFPE) human tonsil sections.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna.

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Ledbetter JA, et al. 1981. J. Exp. Med. 153:310.
  2. Campanelli R, et al. 2002. Intl. Immunol. 14:39.
  3. Evans RL, et al. 1981. Immunol. 78:544.
  4. Wooldridge L, et al. 2005. J. Bio. Chem. 280:27491.
  5. Ch'el IL, et al. 2011. J Exp Med. 208:633. PubMed
  6. Carbone A, et al. 1999. Blood 93:2319. (IHC-F)
  7. Ahmed A, et al. 2001. J. Pathol. 193:383. (IHC)
  8. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
  9. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  10. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID
AB_2894552 (BioLegend Cat. No. 344767)

Antigen Details

Structure
Ig superfamily, homodimer or heterodimer with CD8b, 32-34 kD
Distribution

Majority of thymocytes, T cell subset, NK cells

Function
MHC class I co-receptor, thymic differentiation, T cell activation
Ligand/Receptor
MHC Class I molecules
Cell Type
NK cells, T cells, Thymocytes
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Barclay N, et al. 1993. The Leucocyte Antigen FactsBook. Academic Press Inc. San Diego.

Gene ID
925 View all products for this Gene ID
UniProt
View information about CD8 on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD8 Reagents Request Custom Conjugation
Description Clone Applications
Alexa Fluor® 647 anti-human CD8 SK1 FC
Brilliant Violet 650™ anti-human CD8 SK1 FC
Purified anti-human CD8 SK1 FC,IHC-F
FITC anti-human CD8 SK1 FC
PE anti-human CD8 SK1 FC
PerCP anti-human CD8 SK1 FC
PerCP/Cyanine5.5 anti-human CD8 SK1 FC
PE/Cyanine7 anti-human CD8 SK1 FC
APC/Cyanine7 anti-human CD8 SK1 FC
Alexa Fluor® 488 anti-human CD8 SK1 FC,SB
Pacific Blue™ anti-human CD8 SK1 FC
Biotin anti-human CD8 SK1 FC
APC anti-human CD8 SK1 FC
Alexa Fluor® 700 anti-human CD8 SK1 FC
Purified anti-human CD8 (Maxpar® Ready) SK1 FC,CyTOF®
Brilliant Violet 510™ anti-human CD8 SK1 FC
Brilliant Violet 711™ anti-human CD8 SK1 FC
Brilliant Violet 785™ anti-human CD8 SK1 FC
Brilliant Violet 605™ anti-human CD8 SK1 FC
PE/Dazzle™ 594 anti-human CD8 SK1 FC
PE anti-human CD8 SK1 FC
APC/Fire™ 750 anti-human CD8 SK1 FC
APC anti-human CD8 SK1 FC
Brilliant Violet 421™ anti-human CD8 SK1 FC
Pacific Blue™ anti-human CD8 SK1 FC
TotalSeq™-A0046 anti-human CD8 SK1 PG
TotalSeq™-C0046 anti-human CD8 SK1 PG
Brilliant Violet 750™ anti-human CD8 SK1 FC
TotalSeq™-B0046 anti-human CD8 SK1 PG
Spark Blue™ 550 anti-human CD8 SK1 FC
PE/Cyanine7 anti-human CD8 SK1 FC
FITC anti-human CD8 SK1 FC
APC/Fire™ 810 anti-human CD8 SK1 FC
PE/Fire™ 640 anti-human CD8 SK1 FC
PE/Fire™ 700 anti-human CD8 SK1 FC
PerCP anti-human CD8 SK1 FC
PerCP/Cyanine5.5 anti-human CD8 SK1 FC
TotalSeq™-D0046 anti-human CD8 SK1 PG
APC/Fire™ 750 anti-human CD8 SK1 FC
GMP APC anti-human CD8 SK1 FC
PE/Cyanine5 anti-human CD8 Antibody SK1 FC
Spark UV™ 387 anti-human CD8 SK1 FC
GMP PE anti-human CD8 SK1 FC
GMP PE/Cyanine7 anti-human CD8 SK1 FC
Spark NIR™ 685 anti-human CD8 SK1 FC
KIRAVIA Blue 520™ anti-human CD8 SK1 FC
GMP FITC anti-human CD8 SK1 FC
GMP Pacific Blue™ anti-human CD8 SK1 FC
GMP PerCP anti-human CD8 SK1 FC
Spark Violet™ 500 anti-human CD8 SK1 FC
GMP APC/Fire™ 750 anti-human CD8 SK1 FC
GMP PerCP/Cyanine 5.5 anti-human CD8 SK1 FC
Alexa Fluor® 660 anti-human CD8a SK1 FC
Spark Blue™ 515 anti-human CD8 SK1 FC
Spark Blue™ 574 anti-human CD8 SK1 FC
Spark Violet™ 538 anti-human CD8 SK1 FC
PE/Fire™ 810 anti-human CD8 SK1 FC
Spark YG™ 593 anti-human CD8 SK1 FC
Go To Top Version: 1    Revision Date: 09/02/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account