- Clone
- NP4D6 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- HLDA8
- Other Names
- E-NPP3, ENPP3
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TAACCGTACCTGCAT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
324631 | 10 µg | 369 CHF |
CD203c, a transmembrane protein and a member of the ectoenzyme family, is involved in the hydrolysis of extracellular oligonucleotides, nucleoside phosphates, and NAD (possesses ATPase and ATP pyrophosphatase activity). The molecular weight of CD203c is between 130 and 150 kD under reducing conditions and 270 kD under non-reducing conditions. CD203c is expressed on basophils and mast cells, and is highly expressed on activated basophils. Secretory glands in endometrium and glioma cells are also positive. CD203c is a multifunctional ectoenzyme involved in the clearance of extracellular nucleotides whose substrates include nucleoside triphosphates, nucleoside diphosphates, cAMP, and NAD.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- HEK-293 cells transfected with human E-NPP3
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) - RRID
-
AB_2904345 (BioLegend Cat. No. 324631)
Antigen Details
- Structure
- Transmembrane ectoenzyme family member involved in the hydrolysis of extracellular oligonucleotides, nucleoside phosphates, and NAD (possesses ATPase and ATP pyrophosphatase activity); reduced molecular weight is 130 and 150 kD, unreduced is 270 kD
- Distribution
-
Basophils and mast cells, highly expressed on activated basophils; secretory glands in endometrium and glioma cells are also positive
- Function
- Multifunctional ectoenzyme involved in the clearance of extracellular nucleotides
- Ligand/Receptor
- Substrates include nucleoside triphosphates, nucleoside diphosphates, cAMP, and NAD
- Cell Type
- Basophils, Mast cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Yano Y, et al. 2003. Int. J. Mol. Med. 12:763.
2. Andoh K, et al. 1999. Biochim. Biophys. Acta. 1446:213. - Gene ID
- 5169 View all products for this Gene ID
- UniProt
- View information about CD203c on UniProt.org
Related FAQs
Other Formats
View All CD203c Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD203c (E-NPP3) | NP4D6 | FC |
PE anti-human CD203c (E-NPP3) | NP4D6 | FC |
Brilliant Violet 510™ anti-human CD203c (E-NPP3) | NP4D6 | FC |
Brilliant Violet 605™ anti-human CD203c (E-NPP3) | NP4D6 | FC |
APC anti-human CD203c (E-NPP3) | NP4D6 | FC |
PerCP/Cyanine5.5 anti-human CD203c (E-NPP3) | NP4D6 | FC |
Brilliant Violet 421™ anti-human CD203c (E-NPP3) | NP4D6 | FC |
FITC anti-human CD203c (E-NPP3) | NP4D6 | FC |
PerCP anti-human CD203c (E-NPP3) | NP4D6 | FC |
PE/Cyanine7 anti-human CD203c (E-NPP3) | NP4D6 | FC |
PE/Dazzle™ 594 anti-human CD203c (E-NPP3) | NP4D6 | FC |
Alexa Fluor® 647 anti-human CD203c (E-NPP3) | NP4D6 | FC |
TotalSeq™-A0593 anti-human CD203c (E-NPP3) | NP4D6 | PG |
TotalSeq™-C0593 anti-human CD203c (E-NPP3) | NP4D6 | PG |
TotalSeq™-D0593 anti-human CD203c (E-NPP3) | NP4D6 | PG |
TotalSeq™-B0593 anti-human CD203c (E-NPP3) | NP4D6 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD203c (E-NPP3)
-
PE anti-human CD203c (E-NPP3)
-
Brilliant Violet 510™ anti-human CD203c (E-NPP3)
-
Brilliant Violet 605™ anti-human CD203c (E-NPP3)
-
APC anti-human CD203c (E-NPP3)
-
PerCP/Cyanine5.5 anti-human CD203c (E-NPP3)
-
Brilliant Violet 421™ anti-human CD203c (E-NPP3)
-
FITC anti-human CD203c (E-NPP3)
-
PerCP anti-human CD203c (E-NPP3)
-
PE/Cyanine7 anti-human CD203c (E-NPP3)
-
PE/Dazzle™ 594 anti-human CD203c (E-NPP3)
-
Alexa Fluor® 647 anti-human CD203c (E-NPP3)
-
TotalSeq™-A0593 anti-human CD203c (E-NPP3)
-
TotalSeq™-C0593 anti-human CD203c (E-NPP3)
-
TotalSeq™-D0593 anti-human CD203c (E-NPP3)
-
TotalSeq™-B0593 anti-human CD203c (E-NPP3)
Follow Us