- Clone
- HIT2 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- III 155
- Other Names
- T10, ADP-ribosyl cyclase
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TGTACCCGCTTGTGA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
303553 | 10 µg | 369 CHF |
CD38 is a 45 kD type II transmembrane glycoprotein also known as T10. It is an ADP-ribosyl hydrolase expressed at variable levels on hematopoietic cells and in some non-hematopoietic tissues (such as brain, muscles, and kidney). In humans, it is expressed at high levels on plasma cells and activated T and B cells. By functioning as both a cyclase and a hydrolase, CD38 mediates lymphocyte activation, adhesion, and the metabolism of cADPR and NAADP. CD31 is the ligand of CD38.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Chimpanzee, Horse, Cow
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections6 and spatial biology (IBEX)10,11.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London.
- Dieu M. 1998. J. Exp. Med. 188:373.
- Esser M, et al. 2001. J. Virol. 75:6173.
- Jeannin P, et al. 1999. J. Immunol. 162:2044.
- Kapsogeorgou EK, et al. 2001. J. Immunol. 166:3107.
- van der Voort R, et al. 1997. J. Exp. Med. 185:2121. (IHC)
- Bende RJ, et al. 2003. Am. J. Pathol. 162:105.
- Lehner M, et al. 2008. J. Leukoc. Biol. 83:883. PubMed
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- RRID
-
AB_2892351 (BioLegend Cat. No. 303553)
Antigen Details
- Structure
- ADP-ribosyl cyclase, ectoenzyme, type II glycoprotein, 45 kD
- Distribution
-
T cells, B cells, NK, myeloid, plasma, and dendritic cells
- Function
- Ecto-ADP-ribosyl cyclase, calcium signaling, cell activation
- Ligand/Receptor
- CD31, hyaluronic acid
- Cell Type
- B cells, Dendritic cells, NK cells, Plasma cells, T cells
- Biology Area
- Immunology
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Ferrero E, et al. 1999. J. Leukoc. Biol. 65:151.
2. Lund F, et al. 1995. Immunol. Today 16:469. - Gene ID
- 952 View all products for this Gene ID
- UniProt
- View information about CD38 on UniProt.org
Related FAQs
Other Formats
View All CD38 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD38
-
FITC anti-human CD38
-
PE anti-human CD38
-
PE/Cyanine5 anti-human CD38
-
Purified anti-human CD38
-
Alexa Fluor® 488 anti-human CD38
-
Alexa Fluor® 647 anti-human CD38
-
PE/Cyanine7 anti-human CD38
-
Biotin anti-human CD38
-
PerCP anti-human CD38
-
PerCP/Cyanine5.5 anti-human CD38
-
Alexa Fluor® 700 anti-human CD38
-
Brilliant Violet 421™ anti-human CD38
-
Brilliant Violet 711™ anti-human CD38
-
Brilliant Violet 785™ anti-human CD38
-
Brilliant Violet 605™ anti-human CD38
-
APC/Cyanine7 anti-human CD38
-
Purified anti-human CD38 (Maxpar® Ready)
-
PE/Dazzle™ 594 anti-human CD38
-
PE anti-human CD38
-
Brilliant Violet 510™ anti-human CD38
-
FITC anti-human CD38
-
PE/Dazzle™ 594 anti-human CD38
-
TotalSeq™-A0389 anti-human CD38
-
TotalSeq™-C0389 anti-human CD38
-
APC/Fire™ 750 anti-human CD38
-
TotalSeq™-B0389 anti-human CD38
-
APC/Fire™ 810 anti-human CD38
-
Spark NIR™ 685 anti-human CD38 Antibody
-
TotalSeq™-D0389 anti-human CD38
-
PerCP/Cyanine5.5 anti-human CD38
-
APC anti-human CD38
-
APC/Fire™ 750 anti-human CD38
-
PE/Cyanine7 anti-human CD38
-
GMP PE anti-human CD38
-
GMP FITC anti-human CD38
-
Pacific Blue™ anti-human CD38
Follow Us