TotalSeq™-D0368 anti-human CD226 (DNAM-1) Antibody

Pricing & Availability
Clone
11A8 (See other available formats)
Regulatory Status
RUO
Other Names
DNAM-1, PTA1, TLiSA1
Isotype
Mouse IgG1, κ
Barcode Sequence
TCTCAGTGTTTGTGG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
338341 10 µg 358 CHF
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

DNAM-1 (CD226) is a ~65 kD glycoprotein expressed on cell surface of T cells, NK cells, monocytes/macrophages, platelets and megakaryocytes and a subset of B cells and a member of the immunoglobulin (Ig)-superfamily containing 2 Ig-like domains of the V-set. The ligands for CD226 are the poliovirus receptor (CD155) and its family member nectin-2 (CD112), which are broadly expressed on epithelial, endothelial and neuronal cells. CD226 is physically associated with LFA-1 in NK cells and activated T cells, and involved in LFA-1-mediated signaling.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Human, African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications include: block NK cell-mediated lysis.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Fuchs A, et al. 2004. J. Immunol. 172:3994.
RRID
AB_2894624 (BioLegend Cat. No. 338341)

Antigen Details

Structure
Ig domain containing adhesion molecule
Distribution

Peripheral blood T cells, NK cells, monocytes/macrophages, platelets and megakaryocytes and a subset of B cells

Function
Receptor involved in intercellular adhesion, lymphocyte signaling, cytotoxicity and lymphokine secretion mediated by cytotoxic T-lymphocyte (CTL) and NK cell
Interaction
Interacts with LFA-1.
Ligand/Receptor
PVR (CD155) and Nectin-2 (CD112)
Cell Type
B cells, Macrophages, Megakaryocytes, Monocytes, NK cells, Platelets, T cells
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Shibuya A et al. 1996. Immunity 4:573.
2. Tahara-Hanaoka S et al. 2004. Int. Immunol. 16:533.
3. Pende D et al. 2005. Mol. Immunol. 42:463.

Gene ID
10666 View all products for this Gene ID
UniProt
View information about CD226 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 08.12.2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD226 (DNAM-1)

  • FITC anti-human CD226 (DNAM-1)

  • PE anti-human CD226 (DNAM-1)

  • APC anti-human CD226 (DNAM-1)

  • PerCP/Cyanine5.5 anti-human CD226 (DNAM-1)

  • PE/Cyanine7 anti-human CD226 (DNAM-1)

  • APC/Fire™ 750 anti-human CD226 (DNAM-1)

  • Brilliant Violet 785™ anti-human CD226 (DNAM-1)

  • Brilliant Violet 605™ anti-human CD226 (DNAM-1)

  • PE/Dazzle™ 594 anti-human CD226 (DNAM-1)

  • Biotin anti-human CD226 (DNAM-1)

  • Brilliant Violet 510™ anti-human CD226 (DNAM-1)

  • Alexa Fluor® 647 anti-human CD226 (DNAM-1)

  • Brilliant Violet 421™ anti-human CD226 (DNAM-1)

  • Brilliant Violet 711™ anti-human CD226 (DNAM-1)

  • TotalSeq™-A0368 anti-human CD226 (DNAM-1)

  • TotalSeq™-C0368 anti-human CD226 (DNAM-1)

  • TotalSeq™-B0368 anti-human CD226 (DNAM-1)

  • TotalSeq™-D0368 anti-human CD226 (DNAM-1)

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account