TotalSeq™-D0158 anti-human CD134 (OX40) Antibody

Pricing & Availability
Clone
Ber-ACT35 (ACT35) (See other available formats)
Regulatory Status
RUO
Other Names
ACT35 antigen, tumor necrosis factor receptor superfamily member 4 (TNFRSF4)
Isotype
Mouse IgG1, κ
Barcode Sequence
AACCCACCGTTGTTA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
350039 10 µg 369 CHF
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD134, also known as OX40 and TNFRSF4, is a 50 kD type I transmembrane glycoprotein. It is a member of the TNF receptor family. OX40 is expressed on activated T lymphocytes including Th1, Th2, Th17, and Treg cells. The interaction of OX40 with OX40L results in B cell proliferation and antibody secretion, regulation of primary T cell expansion, and T cell survival. OX40 influences the size of the T cell memory pool and regulation of CD4+ T cell tolerance.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
Chimpanzee
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
HTLV 1-transformed HUT 102 cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: Western blotting1, immunoprecipitation1, immunohistochemical staining2,3of paraffin embedded7 and frozen tissue sections, ELISA4, and functional assay5. The LEAF™ or Ultra-LEAF™ purified antibody is recommended for functional assays (contact our custom solutions team).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Latza U, et al. 1994. Eur. J. Immunol. 24:677. (WB, IP)
  2. Durkop H, et al. 1995. Brit. J. Haematol. 91:927. (IHC)
  3. Durkop H, et al. 1997. Brit. J. Haematol. 98:863. (IHC)
  4. Willett B, et al. 2007. J. Virol. 81:9665. (ELISA)
  5. Li M and Zhang Y. et al. 2005. Cell. Mol. Immunol. 2:467. (FA)
  6. Gloviczki ML, et al. 2012. Clin. J. Am. Soc. Nephrol. 8:546. PubMed
  7. Domingos PL, et al. 2012. An. Bras. Dermatol. 87:851. (IHC)
RRID
AB_2892425 (BioLegend Cat. No. 350039)

Antigen Details

Structure
50 kD, TNF receptor family
Distribution

Activated T cells

Function
Receptor for OX40 ligand, co-stimulatory signal for T cell proliferation and survival.
Ligand/Receptor
OX40L (CD252)
Cell Type
T cells, Tregs
Biology Area
Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Costimulatory Molecules, Immunology
Molecular Family
CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Smith CA, et al. 1994. Cell. 76:959.
2. Chen AL, et al. 1999. Immunity. 11:689.
3. Croft M. 2010. Annu. Rev. Immunol. 28:57.
4. Withers DR, et al. 2009. J. Immunol. 183:5079.
5. Klinger M, et al. 2009. J. Immunol. 182:4581.

Gene ID
7293 View all products for this Gene ID
UniProt
View information about CD134 on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD134 Reagents Request Custom Conjugation
Description Clone Applications
FITC anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
Purified anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC,IHC-P,ELISA,IHC-F,WB
PE anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
APC anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
PerCP/Cyanine5.5 anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
PE/Cyanine7 anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
Brilliant Violet 421™ anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
Purified anti-human CD134 (OX40) (Maxpar® Ready) Ber-ACT35 (ACT35) FC,CyTOF®
Alexa Fluor® 647 anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
PE/Dazzle™ 594 anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
APC/Cyanine7 anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
Biotin anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
Brilliant Violet 510™ anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
Brilliant Violet 605™ anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
APC/Fire™ 750 anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
Brilliant Violet 711™ anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
TotalSeq™-A0158 anti-human CD134 (OX40) Ber-ACT35 (ACT35) PG
TotalSeq™-C0158 anti-human CD134 (OX40) Ber-ACT35 (ACT35) PG
TotalSeq™-B0158 anti-human CD134 (OX40) Ber-ACT35 (ACT35) PG
TotalSeq™-D0158 anti-human CD134 (OX40) Ber-ACT35 (ACT35) PG
PE/Cyanine5 anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
PE/Fire™ 810 anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
PE anti-human CD134 Ber-ACT35 (ACT35) FC
PE/Fire™ 744 anti-human CD134 (OX40) Ber-ACT35 (ACT35) FC
Go To Top Version: 1    Revision Date: 05.20.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account