TotalSeq™-D0125 anti-human CD44 Antibody

Pricing & Availability
Clone
BJ18 (See other available formats)
Regulatory Status
RUO
Workshop
VI A034
Other Names
Hermes, Pgp-1, H-CAM, HUTCH-1, ECMR III, gp85, Ly-24
Isotype
Mouse IgG1, κ
Barcode Sequence
AATCCTTCCGAATGT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
338835 10 µg 369 CHF
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD44 is a 80-95 kD glycoprotein also known as Hermes, Pgp1, H-CAM, or HUTCH. It is expressed on all leukocytes, endothelial cells, hepatocytes, and mesenchymal cells. As B and T cells become activated or progress to the memory stage, CD44 expression increases from a low or mid level of intensity to high expression levels. Thus, CD44 has been reported to be a valuable marker for memory cell subsets. CD44 is an adhesion molecule involved in leukocyte attachment to and rolling on endothelial cells, homing to peripheral lymphoid organs and to the sites of inflammation, and leukocyte aggregation.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Normal human PBL
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Kishimoto T, et al. eds. 1997 Leucocyte Typing VI:White Cell Differentiation Antigen. Garland Publishing Inc.
RRID
AB_2892410 (BioLegend Cat. No. 338835)

Antigen Details

Structure
Variable splicing of CD44 gene generates many CD44 isoforms, 85 kD
Distribution

All leukocytes, epithelial cells, endothelial cells, hepatocytes, mesenchymal cells

Function
Leukocyte attachment and rolling on endothelial cells, stromal cells and ECM
Ligand/Receptor
Hyaluronan, MIP-1β, fibronectin, collagen
Cell Type
Endothelial cells, Epithelial cells, Leukocytes, Mesenchymal cells, Mesenchymal Stem Cells, Tregs
Biology Area
Cell Adhesion, Cell Biology, Immunology, Stem Cells
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Barclay AN, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Haynes BF, et al. 1991. Cancer Cells 3:347.
3. Goldstein LA, et al. 1989. Cell 56:1063.
4. Mikecz K, et al. 1995. Nat. Med. 1:558.

Gene ID
960 View all products for this Gene ID
UniProt
View information about CD44 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05.24.2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD44

  • FITC anti-human CD44

  • APC anti-human CD44

  • PE anti-human CD44

  • Brilliant Violet 421™ anti-human CD44

  • Purified anti-human CD44 (Maxpar® Ready)

  • Alexa Fluor® 700 anti-human CD44

  • PE/Dazzle™ 594 anti-human CD44

  • PE/Cyanine7 anti-human CD44

  • APC/Fire™ 750 anti-human CD44

  • PerCP/Cyanine5.5 anti-human CD44

  • Pacific Blue™ anti-human CD44

  • TotalSeq™-A0125 anti-human CD44

  • TotalSeq™-C0125 anti-human CD44

  • Alexa Fluor® 488 anti-human CD44

  • Brilliant Violet 785™ anti-human CD44

  • TotalSeq™-B0125 anti-human CD44 Antibody

  • TotalSeq™-D0125 anti-human CD44

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account