TotalSeq™-D0089 anti-human TIGIT (VSTM3) Antibody

Pricing & Availability
A15153G (See other available formats)
Regulatory Status
Other Names
T-cell immunoreceptor with Ig and ITIM domains, VSIG9, VSTM3, WUCAM
Mouse IgG2a, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
372739 10 µg 369 CHF
Check Availability

Need larger quantities of this item?
Request Bulk Quote

T cell immunoreceptor with Ig and ITIM domains (TIGIT), also known as VSTM3 or WUCAM, is a 26 kD, type I transmembrane protein and is a member of the PVR (poliovirus receptor) family of immunoglobulin-like domain containing proteins. TIGIT is expressed on activated T cells, follicular T helper, memory, and regulatory T cells as well as on NK cells. TIGIT is a negative regulator of NK and T cell activation. Expression of TIGIT is associated with decreased functionality of CD8 T cells in chronic viral infection and tumors. TIGIT also promotes the differentiation of tolerogenic phenotype in dendritic cells with an increased secretion of IL-10 and a diminished production of IL-12.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Antibody Type
Host Species
Recombinant Human TIGIT.
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

This clone can suppress anti-CD3 induced T cell proliferation in vitro based on in-house testing.

This clone has been tested in-house and determined to not be suitable for applications in immunohistochemistry of paraffin-embedded tissue sections (IHC-P).

Additional reported applications (for the relevant formats) include: Blocking1.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Stamm H, et al. 2018. Oncogene. Pubmed
AB_2892456 (BioLegend Cat. No. 372739)

Antigen Details

26kD; type I transmembrane protein, Ig-like V-type domain, ITIM motif.

Activated T cells, Regulatory T cells (Treg), Follicular Helper T cells (TFH), NK cells.

Cell signaling, negative regulation of T cells, T cell tolerance, T cell anergy.
CD155 (PVR), CD112 (PVRL2, NECTIN-2).
Cell Type
NK cells, T cells, Tfh, Tregs
Biology Area
Cell Adhesion, Cell Biology, Immunology, Inhibitory Molecules, Signal Transduction
Molecular Family
Adhesion Molecules, Immune Checkpoint Receptors
Antigen References

1. Stanietsky N, et al. 2009. Proc. Natl. Acad. Sci. 106:17858.
2. Yu X, et al. 2009. Nat. Immunol. 10:48.
3. Johnston R, et al. 2014. Cancer Cell. 26:923.

Gene ID
201633 View all products for this Gene ID
View information about TIGIT on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05.24.2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human TIGIT (VSTM3)

  • APC/Fire™ 750 anti-human TIGIT (VSTM3)

  • APC anti-human TIGIT (VSTM3)

  • PE anti-human TIGIT (VSTM3)

  • Brilliant Violet 421™ anti-human TIGIT (VSTM3)

  • Brilliant Violet 605™ anti-human TIGIT (VSTM3)

  • PE/Dazzle™ 594 anti-human TIGIT (VSTM3)

  • PerCP/Cyanine5.5 anti-human TIGIT (VSTM3)

  • PE/Cyanine7 anti-human TIGIT (VSTM3)

  • Ultra-LEAF™ Purified anti-human TIGIT (VSTM3)

  • Biotin anti-human TIGIT (VSTM3)

  • Alexa Fluor® 647 anti-human TIGIT (VSTM3)

  • TotalSeq™-A0089 anti-human TIGIT (VSTM3)

  • TotalSeq™-B0089 anti-human TIGIT (VSTM3)

  • TotalSeq™-C0089 anti-human TIGIT (VSTM3)

  • KIRAVIA Blue 520™ anti-human TIGIT (VSTM3)

  • APC/Cyanine7 anti-human TIGIT (VSTM3)

  • Brilliant Violet 510™ anti-human TIGIT (VSTM3)

  • Brilliant Violet 785™ anti-human TIGIT (VSTM3) Antibody

  • TotalSeq™-D0089 anti-human TIGIT (VSTM3)

  • Brilliant Violet 711™ anti-human TIGIT (VSTM3)

  • PE/Fire™ 640 anti-human TIGIT (VSTM3)

  • PE/Fire™ 810 anti-human TIGIT (VSTM3)


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account