TotalSeq™-D0081 anti-human CD14 Antibody

Pricing & Availability
M5E2 (See other available formats)
Regulatory Status
III 329
Other Names
LPS receptor
Mouse IgG2a, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
301865 10 µg 325,00 CHF
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD14 is a 53-55 kD glycosylphosphatidylinositol (GPI)-linked membrane glycoprotein also known as LPS receptor. CD14 is expressed at high levels on monocytes and macrophages, and at lower levels on granulocytes. Some dendritic cell populations such as interfollicular dendritic cells, reticular dendritic cells, and Langerhans cells have also been reported to express CD14. As a high-affinity receptor for LPS, CD14 is involved in the clearance of gram-negative pathogens, and in the upregulation of adhesion molecules and expression of cytokines in monocytes and neutrophils.

Product Details
Technical Data Sheet (pdf)

Product Details

Human, African Green, Capuchin Monkey, Cattle (Bovine, Cow), Chimpanzee, Common Marmoset, Cotton-topped Tamarin, Cynomolgus, Dog (Canine), Rhesus, Pigtailed Macaque, Squirrel Monkey
Antibody Type
Host Species
Full-length human CD14 protein
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The M5E2 antibody inhibits monocyte activation and cytokine production induced by LPS. Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections, blocking of LPS stimulation4, and immunofluorescence microscopy5. Clone M5E2 is not recommended for immunohistochemical staining of formalin-fixed paraffin-embedded sections. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 301861 and 301862).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. McMichael A, et al. 1987. Leucocyte Typing III. Oxford University Press. New York.
  2. Knapp W, et al. Eds. 1989. Leucocyte Typing IV. Oxford University Press. New York. (IHC-F)
  3. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
  4. Power CP, et al. 2004. J. Immunol. 173:5229. (Block)
  5. Williams KC, et al. 2001. J. Exp. Med. 193:905.
  6. Iwamoto S, et al. 2007. J. Immunol. 179:1449. (FC) PubMed
  7. Santer DM, et al. 2010. J. Immunol. 485:4739. PubMed
  8. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  9. Zizzo G, et al. 2012. J. Immunol. 189:3508. PubMed
  10. Stoeckius M, et al. 2017. Nat. Methods. 14:865. (PG)
  11. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
Product Citations
AB_2892347 (BioLegend Cat. No. 301865)

Antigen Details

GPI-linked membrane glycoprotein, 53-55 kD

Monocytes, macrophages, granulocytes (low)

LPS receptor, clearance of Gram-negative pathogens
Cell Type
Granulocytes, Macrophages, Monocytes, Neutrophils
Biology Area
Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
Molecular Family
CD Molecules
Antigen References

1. Stocks S, et al. 1990. Biochem. J. 268:275.
2. Wright S, et al. 1990. Science 249:1434.

Gene ID
929 View all products for this Gene ID
View information about CD14 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05.24.2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Insert Note Here
Save Close Clear
Lab Timer
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account