- Clone
- T5-39 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- LIGHT, TL5, TNFSF14, TR2 ligand, Ligand for herpesvirus entry mediator, tumor necrosis factor receptor-like-2 ligand, tumor necrosis factor ligand superfamily member 14 (TNFSF14)
- Isotype
- Mouse IgG2b, κ
- Barcode Sequence
- ACTTCCCTGTAGAAA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
318713 | 10 µg | $369 |
The T5-39 antibody recognizes human LIGHT (CD258) also known as ligand for herpesvirus entry mediator, tumor necrosis factor receptor-like-2 ligand, TR2 ligand, and tumor necrosis factor ligand superfamily member 14 (TNFSF14). LIGHT is a type 2 transmembrane protein, and a member of the tumor necrosis factor ligand superfamily. LIGHT can be proteolytically cleaved and two isofoms have been shown to be produced by alternative splicing. The apparent molecular weight of LIGHT us approximately 30 kD. LIGHT expression has been observed in spleen, brain and kidney; expression is upregulated on activated T cells (particularly CD8+ cells). LIGHT stimulates proliferation of T cells and inhibits growth of some tumor cells. This protein has been shown to play a role in intestinal inflammation and contribute to IgA nephropathy. LIGHT is a ligand for HVEM, and LTβR and has also been shown to bind DcR3 and modulate function. In addition, LIGHT has been shown to interact with other proteins including TRAF2, TRAF3, and DIABLO. The T5-39 antibody has been shown to be useful for flow cytometry and ELISA.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- recombinant human LIGHT (TL5) protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2894617 (BioLegend Cat. No. 318713)
Antigen Details
- Structure
- Type 2 transmembrane protein, member of the tumor necrosis factor ligand superfamily. Can be proteolytically cleaved; two isofoms produced by alternative splicing. Apparent molecular weight approximately 30 kD.
- Distribution
-
Spleen, brain and kidney. Upregulated on activated T cells (particularly CD8+ cells)
- Function
- Stimulates proliferation of T cells, inhibits growth of some tumor cells. Has been shown to play a role in intestinal inflammation and contribute to IgA nephropathy
- Interaction
- TRAF2, TRAF3, DIABLO
- Ligand/Receptor
- Ligand for HVEM, LTβR. Has also been shown to bind DcR3
- Cell Type
- T cells
- Biology Area
- Cell Biology, Immunology
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors
- Antigen References
-
1. Mauri DN, et al. 1998. Immunity 8:21.
2. Harrop JA, et al. 1998. J. Biol. Chem. 273:27548.
3. Morel Y, et al. 2000. J. Immunol. 165:4397.
4. Wang J, et al. 2004. J. Clin. Invest. 113:826.
5. Yu P, et al. 2004. Nature Immunol. 5:141. - Gene ID
- 8740 View all products for this Gene ID
- UniProt
- View information about CD258 on UniProt.org
Related FAQs
Other Formats
View All CD258 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Biotin anti-human CD258 (LIGHT) | T5-39 | FC |
PE anti-human CD258 (LIGHT) | T5-39 | FC |
PE/Cyanine7 anti-human CD258 (LIGHT) | T5-39 | FC |
APC anti-human CD258 (LIGHT) | T5-39 | FC |
TotalSeq™-C1056 anti-human CD258 (LIGHT) | T5-39 | PG |
TotalSeq™-D1056 anti-human CD258 (LIGHT) | T5-39 | PG |
TotalSeq™-B1056 anti-human CD258 (LIGHT) | T5-39 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
Follow Us