TotalSeq™-D0574 anti-human CD235a (Glycophorin A) Antibody

Pricing & Availability
HI264 (See other available formats)
Regulatory Status
VII 70312
Other Names
PAS-2, Sialoglycoprotein alpha, MN sialoglycoprotein, Glycophorin A, MNS blood group
Mouse IgG2a, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
349125 10 µg $325.00
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD235a (Glycophorin A) is member of the glycophorin A family. It is a type I sialoglycoprotein with a molecular weight of 10 kD, present in the cell membrane as a homodimer. Glycophorin A is expressed by erythroid precursors and erythrocytes.  It carries the antigen determinants for the MNS blood groups and has been proposed to be an inhibitor of hemagglutination and hemolysis. Glycophorin A binds siglec 5, the erythrocyte binding antigen (EBA-175) of P. falciparum and some viruses, including influenza virus and hepatitis A virus.

Product Details
Technical data sheet

Product Details

Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Mason D, et al. Eds. 2002. Leucocyte Typing VII:White Cell Differentiation Antigens. Oxford University Press. (FC)

Antigen Details

Member of the glycophorin A family; type I protein with a molecular weight of 10 kD; present in the membrane as homodimer

Erythrocytes and erythroid precursors

Possible inhibitor of hemagglutination and hemolysis; carries the antigen determinants for the MNS blood groups
Siglec 5, erythrocyte binding antigen (EBA-175) of P. falciparum, receptor for the influenza virus, hepatitis A virus
Cell Type
Biology Area
Cell Adhesion, Cell Biology, Immunology
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Reid ME. 2009. Immunohematology 25:95.
2. Palacajornsuk P. 2006. Immunohematology 22:171.
3. Pasvol G. 2003. Trends Parasitol. 19:430.
4. Takakuwa Y. 2001. Curr. Opin. Hematol. 8:80.

Gene ID
2993 View all products for this Gene ID
View information about CD235a on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/15/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Insert Note Here
Save Close Clear
Lab Timer
Remember me
Forgot your password? Reset Password
Request an Account