TotalSeq™-D0083 anti-human CD16 Antibody

Pricing & Availability
Clone
3G8 (See other available formats)
Regulatory Status
RUO
Workshop
V NK80
Other Names
FcγRIII, Fc gamma receptor, Fc gamma receptor 3
Isotype
Mouse IgG1, κ
Barcode Sequence
AAGTTCACTCTTTGC
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
302071 10 µg $325
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD16 is known as low affinity IgG receptor III (FcγRIII). It is expressed as two distinct forms (CD16a and CD16b). CD16a (FcγRIIIA) is a 50-65 kD polypeptide-anchored transmembrane protein. It is expressed on the surface of NK cells, activated monocytes, macrophages, and placental trophoblasts in humans. CD16b (FcγRIIIB) is a 48 kD glycosylphosphatidylinositol (GPI)-anchored protein. Its extracellular domain is over 95% homologous to that of CD16a, and it is expressed specifically on neutrophils. CD16 binds aggregated IgG or IgG-antigen complex which functions in NK cell activation, phagocytosis, and antibody-dependent cell-mediated cytotoxicity (ADCC).

Product Details
Technical data sheet

Product Details

Reactivity
Human, African Green, Baboon, Capuchin Monkey, Chimpanzee, Cynomolgus, Marmoset, Pigtailed Macaque, Rhesus, Sooty Mangabey, Squirrel Monkey
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human PMN cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The 3G8 antibody clone blocks neutrophil phagocytosis and stimulates NK cell proliferation. It has been reported that this clone interacts with the FcγRIIa and FcγRIIIb receptors causing neutrophil activation and aggregation18. Due to this phenomenon staining in whole blood may cause a reduction in the number of granulocytes or alter their scatter profile.

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections6, immunoprecipitation3, stimulation of NK cell proliferation4, blocking of phagocytosis5, and blocking of immunoglobulin binding to FcγRIII7,8. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 302049, 302050, 302057, 302058).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Knapp W, et al. Eds. 1989. Leucocyte Typing IV. Oxford University Press. New York.
  2. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
  3. Edberg J, et al. 1997. J. Immunol. 159:3849. (IP)
  4. Hoshino S, et al. 1991. Blood 78:3232. (Stim)
  5. Tamm A, et al. 1996. Immunol. 157:1576. (Block)
  6. Da Silva DM, et al. 2001. Int. Immunol. 13:633. (IHC)
  7. Holl V, et al. 2004. J. Immunol. 173:6274. (Block)
  8. Hober D, et al. 2002. J. Gen. Virol. 83:2169. (Block)
  9. Brainard DM, et al. 2009. J. Virol. 83:7305. PubMed
  10. Smed-Sörensen A, et al. 2008. Blood 111:5037. (Block) PubMed
  11. Timmerman KL, et al. 2008. J. Leukoc. Biol. 84:1271. (FC) PubMed
  12. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  13. Rout N, et al. 2010. PLoS One 5:e9787. (FC)
  14. Kim WK, et al. 2006. Am. J. Pathol. 168:822. (FC)
  15. Boltz A, et al. 2011. J. Biol Chem. 286:21896. PubMed
  16. Wu Z, et al. 2013. J. Virol. 87:7717. PubMed
  17. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
  18. Vossebeld PJ, et al. 1997. Biochem J. 323:87-94 (Stim)

Antigen Details

Structure
Ig superfamily, transmembrane form (50-65 kD) or GPI-linked form (48 kD)
Distribution

NK cells, activated monocytes, macrophages, neutrophils

Function
Low affinity IgG Fc receptor, phagocytosis, ADCC
Ligand/Receptor
Aggregated IgG, IgG-antigen complex
Cell Type
Dendritic cells, Macrophages, Monocytes, Neutrophils, NK cells
Biology Area
Immunology, Innate Immunity
Molecular Family
CD Molecules, Fc Receptors
Antigen References

1. Fleit H, et al. 1982. P. Natl. Acad. Sci. USA 79:3275.
2. Stroncek D, et al. 1991. Blood 77:1572.
3. Wirthmueller U, et al. 1992. J. Exp. Med. 175:1381.

Gene ID
2214 View all products for this Gene ID
UniProt
View information about CD16 on UniProt.org

Related FAQs

Is our human Trustain FcX™ (cat# 422302) compatible with anti human CD16, CD32 and CD64 clones 3G8, FUN-2 and 10.1 respectively?

Yes

Go To Top Version: 1    Revision Date: 05/24/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Insert Note Here
Save Close Clear
Lab Timer
Tools
Login/Register
Remember me
Forgot your password? Reset Password
Request an Account