TotalSeq™-D0919 anti-human MICA/MICB Antibody

Pricing & Availability
6D4 (See other available formats)
Regulatory Status
Other Names
PERB11, MIC, MHC class I chain-related protein A, MICA, PERB11.1, MHC class I chain-related protein B, MICB, PERB11.2
Mouse IgG2a, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
320923 10 µg $369
Check Availability

Need larger quantities of this item?
Request Bulk Quote

6D4 antibody reacts with a common epitope of the human nonclassical MHC class I chain-related protein A (MICA) and B (MICB), also known as PERB11.1 and PERB11.2. The MIC gene is located in MHC class I region. MICA/B are 65-75 kD stress-inducible glycoproteins with highly polymorphic. They are MHC class I-like transmembrane molecules that do not associate β2-microglobulin and do not present peptides. MICA and MICB share 85% identify, and are mainly expressed on Intestinal epithelial cells, epithelial tumor cells, endothelial cells, fibroblasts, and IFN-α-stimulated dendritic cells. MIC molecules bind NKG2D, an activating receptor, and induce activation of NK cells, and subset of CD8+ α/β T cells and γ/δ T cells, as well as suppression of T cell proliferation. MICA/B recognition is involved in the regulation of tumor surveillance, viral infection and autoimmune diseases. The 6D4 antibody is able to block MIC mediated cytotoxicity.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported (for the relevant formats) applications include: immunohistochemistry2,3,5 of acetone-fixed frozen sections and formalin-fixed paraffin-embedded tissue sections, immunoprecipitation7, and blocking2,3 of MIC mediated cytotoxicity. The Ultra-LEAF™ Purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 320919 & 320120).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Groh V, et al. 1999. Science 279:1737.
  2. Groh V, et al. 1999. Proc. Natl. Acad. Sci. USA. 96:6879.
  3. Groh V, et al. 2001. Nature Immunol. 2:255.
  4. Li Z, et al. 2000. Immunogenetics 51:246.
  5. Park EJ, et al. 2003. J. Immunol. 171:4131.
  6. Jinushi M, et al. 2003. J. Immunol. 171:5423.
  7. Wu J, et al. 2003. J. Immunol. 170:4196.
AB_2894688 (BioLegend Cat. No. 320923)

Antigen Details

65-75 kD glycoprotein, MHC class I-like transmembrane molecules that do not associate ß2-microglobulin, highly polymorphic

Intestinal epithelium, epithelial tumors, endothelial cells, fibroblasts, INF-a-stimulated dendritic cells

Activation of NK cells, subset of CD8+ α/ß T cells and γ/δ T cells, suppression of T cell proliferation
Cell Type
Dendritic cells, Endothelial cells, Epithelial cells, Fibroblasts
Biology Area
Immunology, Innate Immunity
Molecular Family
MHC Antigens
Antigen References

1. Groh V, et al. 1996. Proc. Natl. Acad. Sci. USA. 93:12445.
2. Groh V, et al. 1999. Proc. Natl. Acad. Sci. USA. 96:6879.
3. Jinushi M, et al. 2003. J. Immunol. 170:1249.
4. Kriegeskorte AK, et al. 2005. Proc. Natl. Acad. Sci. USA. 102:11805.
5. Groh V, et al. 1999. Science 279:1737.

Gene ID
100507436 View all products for this Gene ID 4277 View all products for this Gene ID
View information about MICA MICB on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 08/12/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human MICA/MICB

  • Biotin anti-human MICA/MICB

  • PE anti-human MICA/MICB

  • APC anti-human MICA/MICB

  • Alexa Fluor® 488 anti-human MICA/MICB

  • Alexa Fluor® 647 anti-human MICA/MICB

  • PerCP/Cyanine5.5 anti-human MICA/MICB

  • PE/Cyanine7 anti-human MICA/MICB

  • Ultra-LEAF™ Purified anti-human MICA/MICB

  • TotalSeq™-A0919 anti-human MICA/MICB Antibody

  • TotalSeq™-D0919 anti-human MICA/MICB

  • TotalSeq™-B0919 anti-human MICA/MICB


Remember me
Forgot your password? Reset Password
Request an Account