- Clone
- HI9a (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V P018
- Other Names
- Tetraspanin, MRP-1, DRAP-24
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GAGTCACCAATCTGC
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
312125 | 10 µg | $369 |
CD9 is a 24 kD type III transmembrane protein also known as tetraspanin, MRP-1 and DRAP-24. It is a member of the tetraspan family (spanning the membrane four times) found on platelets, B cell progenitors, activated lymphocytes, granulocytes, endothelial cells and epithelial cells. CD9 induces adhesion, platelet aggregation, and B cell development. CD9 has been shown to associate with CD63, CD81, CD82, and CD36 and to bind to β1 integrins.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cow, Cynomolgus, Dog, Horse, Rabbit, Rhesus, Sheep
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG – Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
- RRID
-
AB_2904339 (BioLegend Cat. No. 312125)
Antigen Details
- Structure
- Tetraspan family, type III transmembrane protein, 24 kD
- Distribution
-
Platelets, B cell progenitors, activated lymphocytes, granulocytes, endothelial and epithelial cells
- Function
- Adhesion, platelet activation, B cell development
- Ligand/Receptor
- Associates with CD63, CD81, CD82 and CD36, binds PSG17
- Cell Type
- B cells, Embryonic Stem Cells, Endothelial cells, Epithelial cells, Granulocytes, Lymphocytes, Platelets
- Biology Area
- Immunology, Stem Cells
- Molecular Family
- CD Molecules
- Antigen References
-
1. Miao WM, et al. 2001. Blood 97:1689.
2. Ellerman DA, et al. 2003. Mol Biol Cell. 14:5098.
3. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York. - Gene ID
- 928 View all products for this Gene ID
- UniProt
- View information about CD9 on UniProt.org
Related FAQs
Other Formats
View All CD9 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD9 | HI9a | FC,ICC |
FITC anti-human CD9 | HI9a | FC |
PE anti-human CD9 | HI9a | FC |
APC anti-human CD9 | HI9a | FC |
PerCP/Cyanine5.5 anti-human CD9 | HI9a | FC |
APC/Fire™ 750 anti-human CD9 | HI9a | FC |
Biotin anti-human CD9 | HI9a | FC |
PE/Cyanine7 anti-human CD9 | HI9a | FC |
PE/Dazzle™ 594 anti-human CD9 | HI9a | FC |
TotalSeq™-A0579 anti-human CD9 | HI9a | PG |
TotalSeq™-C0579 anti-human CD9 | HI9a | PG |
TotalSeq™-B0579 anti-human CD9 Antibody | HI9a | PG |
TotalSeq™-D0579 anti-human CD9 | HI9a | PG |
APC/Fire™ 750 anti-human CD9 | HI9a | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD9
-
FITC anti-human CD9
-
PE anti-human CD9
-
APC anti-human CD9
-
PerCP/Cyanine5.5 anti-human CD9
-
APC/Fire™ 750 anti-human CD9
-
Biotin anti-human CD9
-
PE/Cyanine7 anti-human CD9
-
PE/Dazzle™ 594 anti-human CD9
-
TotalSeq™-A0579 anti-human CD9
-
TotalSeq™-C0579 anti-human CD9
-
TotalSeq™-B0579 anti-human CD9 Antibody
-
TotalSeq™-D0579 anti-human CD9
-
APC/Fire™ 750 anti-human CD9
Follow Us