TotalSeq™-D0392 anti-human CD15 (SSEA-1) Antibody

Pricing & Availability
W6D3 (See other available formats)
Regulatory Status
HCDM listed
Other Names
Lewis X, 3-FAL, 3-FL, LNFP III, Lex , SSEA-1, X-hapten
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
323059 10 µg $358
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD15 is 3-fucosyl-N-acetyllactosamine (3-FAL) also known as Lewis X, 3-FAL, X-hapten, and SSEA-1. CD15 is expressed on granulocytes and monocytes. It has also been shown to be expressed on Langerhans cells. CD15 has been implicated in adhesion as well as chemotaxis, phagocytosis, and bactericidal activity.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Antibody Type
Host Species
WERI-RB-1 retinoblastoma cell line
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

AB_2904344 (BioLegend Cat. No. 323059)

Antigen Details


Neutrophils, eosinophils, monocytes

Cell Type
Embryonic Stem Cells, Eosinophils, Neutrophils
Biology Area
Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family
CD Molecules
Antigen References

1. Stocks SC, et al. 1990. Biochem. J. 268:275.

Gene ID
2526 View all products for this Gene ID
View information about CD15 on

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD15 Reagents Request Custom Conjugation
Description Clone Applications
Brilliant Violet 785™ anti-human CD15 (SSEA-1) W6D3 FC
Purified anti-human CD15 (SSEA-1) W6D3 FC, CyTOF®
FITC anti-human CD15 (SSEA-1) W6D3 FC
PE anti-human CD15 (SSEA-1) W6D3 FC
APC anti-human CD15 (SSEA-1) W6D3 FC
Alexa Fluor® 488 anti-human CD15 (SSEA-1) W6D3 FC
Alexa Fluor® 647 anti-human CD15 (SSEA-1) W6D3 FC
PE/Cyanine5 anti-human CD15 (SSEA-1) W6D3 FC
PerCP anti-human CD15 (SSEA-1) W6D3 FC
PerCP/Cyanine5.5 anti-human CD15 (SSEA-1) W6D3 FC
Pacific Blue™ anti-human CD15 (SSEA-1) W6D3 FC
Alexa Fluor® 700 anti-human CD15 (SSEA-1) W6D3 FC
Brilliant Violet 510™ anti-human CD15 (SSEA-1) W6D3 FC
PE/Cyanine7 anti-human CD15 (SSEA-1) W6D3 FC
Brilliant Violet 605™ anti-human CD15 (SSEA-1) W6D3 FC
Brilliant Violet 650™ anti-human CD15 (SSEA-1) W6D3 FC
Purified anti-human CD15 (SSEA-1) (Maxpar® Ready) W6D3 FC, CyTOF®
PE/Dazzle™ 594 anti-human CD15 (SSEA-1) W6D3 FC
Brilliant Violet 421™ anti-human CD15 (SSEA-1) W6D3 FC
APC/Fire™ 750 anti-human CD15 (SSEA-1) W6D3 FC
FITC anti-human CD15 (SSEA-1) W6D3 FC
Pacific Blue™ anti-human CD15 (SSEA-1) W6D3 FC
TotalSeq™-A0392 anti-human CD15 (SSEA-1) W6D3 PG
Brilliant Violet 711™ anti-human CD15 (SSEA-1) W6D3 FC
APC/Cyanine7 anti-human CD15 (SSEA-1) W6D3 FC
TotalSeq™-B0392 anti-human CD15 (SSEA-1) W6D3 PG
TotalSeq™-C0392 anti-human CD15 (SSEA-1) W6D3 PG
PE anti-human CD15 (SSEA-1) W6D3 FC
APC/Fire™ 810 anti-human CD15 (SSEA-1) Antibody W6D3 FC
TotalSeq™-D0392 anti-human CD15 (SSEA-1) W6D3 PG
GMP FITC anti-human CD15 (SSEA-1) W6D3 FC
Spark YG™ 593 anti-human CD15 (SSEA-1) W6D3 FC
Go To Top Version: 1    Revision Date: 11/15/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Brilliant Violet 785™ anti-human CD15 (SSEA-1)

  • Purified anti-human CD15 (SSEA-1)

  • FITC anti-human CD15 (SSEA-1)

  • PE anti-human CD15 (SSEA-1)

  • APC anti-human CD15 (SSEA-1)

  • Alexa Fluor® 488 anti-human CD15 (SSEA-1)

  • Alexa Fluor® 647 anti-human CD15 (SSEA-1)

  • PE/Cyanine5 anti-human CD15 (SSEA-1)

  • PerCP anti-human CD15 (SSEA-1)

  • PerCP/Cyanine5.5 anti-human CD15 (SSEA-1)

  • Pacific Blue™ anti-human CD15 (SSEA-1)

  • Alexa Fluor® 700 anti-human CD15 (SSEA-1)

  • Brilliant Violet 510™ anti-human CD15 (SSEA-1)

  • PE/Cyanine7 anti-human CD15 (SSEA-1)

  • Brilliant Violet 605™ anti-human CD15 (SSEA-1)

  • Brilliant Violet 650™ anti-human CD15 (SSEA-1)

  • Purified anti-human CD15 (SSEA-1) (Maxpar® Ready)

  • PE/Dazzle™ 594 anti-human CD15 (SSEA-1)

  • Brilliant Violet 421™ anti-human CD15 (SSEA-1)

  • APC/Fire™ 750 anti-human CD15 (SSEA-1)

  • FITC anti-human CD15 (SSEA-1)

  • Pacific Blue™ anti-human CD15 (SSEA-1)

  • TotalSeq™-A0392 anti-human CD15 (SSEA-1)

  • Brilliant Violet 711™ anti-human CD15 (SSEA-1)

  • APC/Cyanine7 anti-human CD15 (SSEA-1)

  • TotalSeq™-B0392 anti-human CD15 (SSEA-1)

  • TotalSeq™-C0392 anti-human CD15 (SSEA-1)

  • PE anti-human CD15 (SSEA-1)

  • APC/Fire™ 810 anti-human CD15 (SSEA-1) Antibody

  • TotalSeq™-D0392 anti-human CD15 (SSEA-1)

  • GMP FITC anti-human CD15 (SSEA-1)

  • Spark YG™ 593 anti-human CD15 (SSEA-1)


Remember me
Forgot your password? Reset Password
Request an Account