TotalSeq™-D0246 anti-human CD122 (IL-2Rβ) Antibody

Pricing & Availability
TU27 (See other available formats)
Regulatory Status
V C050
Other Names
IL-2 Receptor β chain, IL-2Rβ
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
339029 10 µg $358
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD122 is a 70-75 kD type I transmembrane glycoprotein and member of the Ig superfamily. It is IL-2 receptor β chain also known as IL-2Rβ, which is also shared by the IL-15 receptor. CD122 is constitutively expressed by NK cells and at lower levels by a subset of T cells. Its expression is upregulated upon activation. The IL-2Rβ chain can combine with either the common γ subunit (γc, CD132) alone or with the γc subunit and the IL-2Rα subunit (CD25) to generate intermediate or high affinity IL-2 receptor complexes, respectively. CD122 expression levels can be upregulated by activation.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Host Species
TL-Mor cell line
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications include (for the relevant formats) include: immunoprecipitation, blocking of IL-2 binding to CD122, and partial inhibition of IL-2 induced cell proliferation.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Takeshita T, et al. 1989. J. Exp. Med. 169:1323.
AB_2894591 (BioLegend Cat. No. 339029)

Antigen Details

Ig superfamily, forms high affinity IL-2 receptor with CD25 and CD132 chains or intermediate affinity receptor with CD132 alone, 70-75 kD

NK cells, T subset

Critical component of IL-2 and IL-15 signaling
IL-2, IL-15
Cell Type
NK cells, T cells, Tregs
Biology Area
Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers Wiley-Liss A John Wiley & Sons Inc, Publication
2. Minami Y, et al. 1993. Annu. Rev. Immunol. 11:245.
3. Suzuki H, et al. 1995. Science 268:1472.

Gene ID
3560 View all products for this Gene ID
View information about CD122 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 08/17/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD122 (IL-2Rβ)

  • PE anti-human CD122 (IL-2Rβ)

  • APC anti-human CD122 (IL-2Rβ)

  • Brilliant Violet 421™ anti-human CD122 (IL-2Rβ)

  • PerCP/Cyanine5.5 anti-human CD122 (IL-2Rβ)

  • PE/Cyanine7 anti-human CD122 (IL-2Rβ)

  • Purified anti-human CD122 (IL-2Rβ) (Maxpar® Ready)

  • PE/Dazzle™ 594 anti-human CD122 (IL-2Rβ)

  • TotalSeq™-C0246 anti-human CD122 (IL-2Rβ)

  • Ultra-LEAF™ Purified anti-human CD122 (IL-2Rβ)

  • TotalSeq™-B0246 anti-human CD122 (IL-2Rβ)

  • KIRAVIA Blue 520™ anti-human CD122 (IL-2Rβ)

  • TotalSeq™-D0246 anti-human CD122 (IL-2Rβ)

  • TotalSeq™-A0246 anti-human CD122 (IL-2Rβ)


Remember me
Forgot your password? Reset Password
Request an Account