TotalSeq™-D0187 anti-human CD79b (Igβ) Antibody

Pricing & Availability
CB3-1 (See other available formats)
Regulatory Status
VI CD79.1
Other Names
Igb, Igβ (Ig-beta), B29
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
341421 10 µg $369
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD79 is a heterodimeric molecule comprised of an α-chain (CD79a) and β-chain (CD79b). A 37-39 kD type I integral membrane protein CD79b is non-covalently associated with CD79a and cell surface IgM to form the B-cell receptor (BCR) complex. CD79b is expressed on the surface of surface Ig (sIg)-positive B cells and in the cytoplasm of sIg-negative B cells. It is essential for signal transduction after surface Ig crosslinking.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.


To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Nakamura T, et al. 1992. P. Natl. Acad. Sci. USA 89:8522.
  2. Garcia Vela J, et al. 1999. Leukemia. 13:1501.
  3. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  4. Rossi EA, et al. 2014. PLoS One. 9:98315. PubMed
AB_2922559 (BioLegend Cat. No. 341421)

Antigen Details

37-39 kD type I integral membrane protein, associate with CD79a and cell surface IgM to form the B-cell receptor (BCR) complex, Ig superfamily.

B cells

From BCR complex, signal transduction
Cell Type
B cells
Biology Area
Molecular Family
CD Molecules
Antigen References

1. Zola H, et al. Eds. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. A John Wiley & Sons Inc.
2. Dylke J, et al. 2007. Immunol. Lett. 112:47

Gene ID
974 View all products for this Gene ID
View information about CD79b on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 03/18/2022

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • PE anti-human CD79b (Igβ)

  • APC anti-human CD79b (Igβ)

  • PerCP/Cyanine5.5 anti-human CD79b (Igβ)

  • Alexa Fluor® 647 anti-human CD79b (Igβ)

  • PE/Cyanine7 anti-human CD79b (Igβ)

  • APC/Fire™ 750 anti-human CD79b (Igβ)

  • TotalSeq™-A0187 anti-human CD79b (Igβ)

  • TotalSeq™-C0187 anti-human CD79b (Igβ)

  • TotalSeq™-B0187 anti-human CD79b (Igβ)

  • TotalSeq™-D0187 anti-human CD79b (Igβ)

  • PE anti-human CD79b

  • APC anti-human CD79b

  • PerCP/Cyanine5.5 anti-human CD79b


Remember me
Forgot your password? Reset Password
Request an Account