TotalSeq™-D0145 anti-human CD103 (Integrin αE) Antibody

Pricing & Availability
Ber-ACT8 (See other available formats)
Regulatory Status
V A067
Other Names
Integrin alpha E (ITGAE)
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
350241 10 µg $369
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD103 is a type I transmembrane glycoprotein also known as αE integrin, integrin αIEL chain, and human mucosal lymphocyte antigen 1. It belongs to the integrin family and is primarily found on intestinal intraepithelial lymphocytes (IEL). CD103 is also expressed on a subpopulation of lamina propria T cells, epithelial dendritic cells, lamina propria-derived dendritic cells, and a small subset of peripheral lymphocytes. Treg cells express high level of CD103. Hairy cell leukemia has also been shown to express CD103. The expression of CD103 on lymphocytes can be induced upon activation and TGF-β stimulation. In association with integrin β7, CD103 is expressed as an αE/β7 heterodimer. Mature CD103 protein can be cleaved into 2 chains, a 150 kD (C-terminal) chain and a 25 kD (N-terminal) chain, which remain linked by disulfide bonds. CD103 binds to E-cadherin and mediates homing of lymphocytes to the intestinal epithelium.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Reported Reactivity
Antibody Type
Host Species
HTLV-1 induced human T cell line MAPS16
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.


To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: Western Blotting1, immunoprecipitation1, and immunohistochemical staining of frozen tissue sections1.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Kruschwitz M, et al. 1991. J. Clin. Pathol. 44:636. (WB, IP, IHC-F)
  2. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
AB_2922567 (BioLegend Cat. No. 350241)

Antigen Details

Type I transmembrane glycoprotein, integrin family; can be cleaved into 150 kD and 25 kD chains; associated with β7 integrin

Majority of intestinal intraepithelial lymphocytes (IEL), subpopulation of lamina propria T cells, epithelial dendritic cells, small subset of peripheral lymphocytes, Treg cells; expressed on hairy cell leukemia

Retention and activation of CD103+ lymphocytes in the intestinal epithelium, regulation of tissue-specific T cell homing
Cell Targets
Integrin β7
Cell Type
Dendritic cells, Lymphocytes, T cells, Tregs
Biology Area
Cell Biology, Immunology, Neuroscience, Synaptic Biology
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Parker CM, et al. 1992. P. Natl. Acad. Sci. USA 89:1924.
2. Kruschwitz M, et al. 1991. J. Clin. Pathol. 44:636.
3. Schon MP, et al. 1999. J. Immunol. 162:6641.
4. Shaw SK, et al. 1994. J. Biol. Chem. 269:6016.

Gene ID
3682 View all products for this Gene ID
View information about CD103 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 03/22/2022

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD103 (Integrin αE)

  • FITC anti-human CD103 (Integrin αE)

  • PE anti-human CD103 (Integrin αE)

  • Alexa Fluor® 488 anti-human CD103 (Integrin αE)

  • Alexa Fluor® 647 anti-human CD103 (Integrin αE)

  • PE/Cyanine7 anti-human CD103 (Integrin αE)

  • Brilliant Violet 421™ anti-human CD103 (Integrin αE)

  • APC anti-human CD103 (Integrin αE)

  • Brilliant Violet 605™ anti-human CD103 (Integrin αE)

  • Biotin anti-human CD103 (Integrin αE)

  • Brilliant Violet 711™ anti-human CD103 (Integrin αE)

  • PE/Dazzle™ 594 anti-human CD103 (Integrin αE)

  • PerCP/Cyanine5.5 anti-human CD103 (Integrin αE)

  • Brilliant Violet 785™ anti-human CD103 (Integrin αE)

  • APC/Cyanine7 anti-human CD103 (Integrin αE)

  • TotalSeq™-A0145 anti-human CD103 (Integrin αE)

  • TotalSeq™-C0145 anti-human CD103 (Integrin αE)

  • TotalSeq™-B0145 anti-human CD103 (Integrin αE)

  • APC/Fire™ 750 anti-human CD103 (Integrin αE)

  • PE/Fire™ 700 anti-human CD103 (Integrin αE) Antibody

  • TotalSeq™-D0145 anti-human CD103 (Integrin αE)

  • PE/Fire™ 640 anti-human CD103 (Integrin αE)


Remember me
Forgot your password? Reset Password
Request an Account