TotalSeq™-D0062 anti-human CD10 Antibody

Pricing & Availability
HI10a (See other available formats)
Regulatory Status
V CD10.7
Other Names
Common acute lymphoblastic leukemia antigen (CALLA), Enkephalinase, Neutral endopeptidase, Neprilysin
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
312239 10 µg $358
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD10 is a 100 kD neutral endopeptidase and a member of the metalloprotease family. It is a type II transmembrane protein also known as common acute lymphoblastic leukemia antigen (CALLA), enkephalinase, and neprilysin. CD10 is expressed on B cell precursors, T cell precursors, and neutrophils. CD10 is involved in B cell development and has been shown to bind opioid enkephalins, bradykinin, angiotensins I and II, and other biologically active peptides.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon, Capuchin monkey, Chimpanzee
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

AB_2892378 (BioLegend Cat. No. 312239)

Antigen Details

Type II transmembrane metalloprotease family, 100 kD

B cell precursors, T cell precursors, neutrophils

Zinc-binding metalloproteinase, B cell development
Biologically active peptides including opioid enkephalins, bradykinin, angiotensions I & II
Cell Type
B cells, Neutrophils
Biology Area
Molecular Family
CD Molecules
Antigen References

1. Shipp M, et al. 1993. Blood 82:1052.
2. Lu B, et al. 1995. J. Exp. Med. 181:2271.

Gene ID
4311 View all products for this Gene ID
View information about CD10 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05/24/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD10

  • PE anti-human CD10

  • PE/Cyanine5 anti-human CD10

  • FITC anti-human CD10

  • APC anti-human CD10

  • APC/Cyanine7 anti-human CD10

  • PE/Cyanine7 anti-human CD10

  • PerCP/Cyanine5.5 anti-human CD10

  • Brilliant Violet 421™ anti-human CD10

  • Brilliant Violet 510™ anti-human CD10

  • Brilliant Violet 605™ anti-human CD10

  • Purified anti-human CD10 (Maxpar® Ready)

  • Brilliant Violet 711™ anti-human CD10

  • PE/Dazzle™ 594 anti-human CD10

  • APC/Fire™ 750 anti-human CD10

  • APC anti-human CD10

  • PE anti-human CD10

  • FITC anti-human CD10

  • TotalSeq™-A0062 anti-human CD10

  • TotalSeq™-C0062 anti-human CD10

  • APC/Fire™ 750 anti-human CD10

  • TotalSeq™-B0062 anti-human CD10

  • PE/Cyanine7 anti-human CD10

  • PerCP/Cyanine5.5 anti-human CD10

  • Brilliant Violet 785™ anti-human CD10

  • TotalSeq™-D0062 anti-human CD10

  • GMP APC anti-human CD10

  • GMP FITC anti-human CD10


Remember me
Forgot your password? Reset Password
Request an Account