TotalSeq™-D0008 anti-human CD273 (B7-DC, PD-L2) Antibody

Pricing & Availability
24F.10C12 (See other available formats)
Regulatory Status
Other Names
B7-DC, PD-L2, PDL2, B7DC
Mouse IgG2a, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
329627 10 µg $369
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD273, known as B7-DC, is also called programmed death ligand 2 (PDL2). This ligand is a 25 kD type I transmembrane protein and a member of B7 family within the immunoglobulin receptor superfamily and is expressed on a subset of dendritic cells, liver and a small subset of macrophages as well as a few transformed cell lines. CD273 has been reported to be stimulatory on dendritic cells when cross-linked and to inhibit T cell activation upon engaging the PD-1 receptor. CD273 has also been reported to bind to an alternative receptor and to mediate T cell activation through such non-PD1 mediated interactions.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Host Species
Human PD-L2 cDNA
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Brown JA, et al. 2003. J. Immunol. 170:1257
  2. Rodig N, et al. 2003. Eur. J. Immunol. 33:3117
AB_2892396 (BioLegend Cat. No. 329627)

Antigen Details

B7 Immunoglobulin superfamily, 25 kD

Dendritic cells, liver, few transformed cell lines, subset of macrophages

Binds to PD-1 and alternative receptor; ligation on DC stimulates, inhibits T cell responses via PD-1 binding, stimulates T cells via alternative receptor binding and promotes tumor immunity
Cell Type
Dendritic cells, Macrophages
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Shin T, et al. 2003. J. Exp. Med. 198:31.
2. Liu X, et al. 2003. J. Exp. Med. 197:1721.
3. Carreno BM, et al. 2002. Annu. Rev. Immunol. 20:29.

Gene ID
80380 View all products for this Gene ID
View information about CD273 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05/25/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD273 (B7-DC, PD-L2)

  • Biotin anti-human CD273 (B7-DC, PD-L2)

  • APC anti-human CD273 (B7-DC, PD-L2)

  • PE anti-human CD273 (B7-DC, PD-L2)

  • Alexa Fluor® 647 anti-human CD273 (B7-DC, PD-L2)

  • Purified anti-human CD273 (B7-DC, PD-L2) (Maxpar® Ready)

  • PE/Dazzle™ 594 anti-human CD273 (B7-DC, PD-L2)

  • Brilliant Violet 421™ anti-human CD273 (B7-DC, PD-L2)

  • TotalSeq™-A0008 anti-human CD273 (B7-DC, PD-L2)

  • TotalSeq™-C0008 anti-human CD273 (B7-DC, PD-L2)

  • Ultra-LEAF™ Purified anti-human CD273 (B7-DC, PD-L2)

  • TotalSeq™-B0008 anti-human CD273 (B7-DC, PD-L2)

  • TotalSeq™-D0008 anti-human CD273 (B7-DC, PD-L2)

  • KIRAVIA Blue 520™ anti-human CD273 (B7-DC, PD-L2)


Remember me
Forgot your password? Reset Password
Request an Account