TotalSeq™-D0152 anti-human CD223 (LAG-3) Antibody

Pricing & Availability
Clone
11C3C65 (See other available formats)
Regulatory Status
RUO
Other Names
CD223, LAG-3, LAG3, lymphocyte-activation gene-3
Isotype
Mouse IgG1, κ
Barcode Sequence
CATTTGTCTGCCGGT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
369339 10 µg 287€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD223, also known as LAG-3, is a 70 kD type I transmembrane glycoprotein that is involved in T-cell signaling. Similar to CD4, CD223 binds MHC class II, but with a higher affinity. CD223 negatively regulates T-cell activation. It is expressed by activated T-cells and natural killer cells (NKs), as well as regulatory T-cells. It is transiently expressed on the surface of activated T-cells in acute conditions but high expression is maintained under tolerizing conditions. CD223 deficiency results in reduced tumor growth. CD223 and PD-1 can act in synergy and reverse exhausted phenotypes, improve tumor rejection, and control viral load.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human LAG-3 transfected cells.
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The staining of clone 11C3C65 cannot be blocked by clone 7H2C65, which is another anti-human CD223 (LAG-3) antibody.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID
AB_2892449 (BioLegend Cat. No. 369339)

Antigen Details

Structure
70 kD transmembrane glycoprotein, Ig superfamily, highly homologous to CD4.
Distribution

Activated T-cells and natural killer cells (NKs) and regulatory T cells.

Function
Negatively regulates T-cell activation.
Ligand/Receptor
Binds MHC class II molecules.
Cell Type
Dendritic cells, NK cells, T cells, Tregs
Biology Area
Immunology, Inhibitory Molecules
Molecular Family
CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Castelli C, et al. 2014. Oncoimmunology. 3(11):e967146.
2. Poirier N, et al. 2011. Clin. Exp. Immunol. 164:265.
3. Juno JA, et al. 2015. Retrovirology. 12:17.
4. Casati C, et al. 2006. Cancer Res. 66:4450.

Gene ID
3902 View all products for this Gene ID
UniProt
View information about CD223 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 06/03/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD223 (LAG-3)

  • Alexa Fluor® 647 anti-human CD223 (LAG-3)

  • PE anti-human CD223 (LAG-3)

  • FITC anti-human CD223 (LAG-3)

  • PE/Cyanine7 anti-human CD223 (LAG-3)

  • PerCP/Cyanine5.5 anti-human CD223 (LAG-3)

  • Brilliant Violet 421™ anti-human CD223 (LAG-3)

  • Brilliant Violet 650™ anti-human CD223 (LAG-3)

  • Brilliant Violet 510™ anti-human CD223 (LAG-3)

  • Brilliant Violet 785™ anti-human CD223 (LAG-3)

  • Brilliant Violet 711™ anti-human CD223 (LAG-3)

  • Brilliant Violet 605™ anti-human CD223 (LAG-3)

  • Alexa Fluor® 488 anti-human CD223 (LAG-3)

  • Biotin anti-human CD223 (LAG-3)

  • PE/Dazzle™ 594 anti-human CD223 (LAG-3)

  • APC/Fire™ 750 anti-human CD223 (LAG-3)

  • TotalSeq™-A0152 anti-human CD223 (LAG-3)

  • TotalSeq™-C0152 anti-human CD223 (LAG-3)

  • TotalSeq™-B0152 anti-human CD223 (LAG-3)

  • TotalSeq™-D0152 anti-human CD223 (LAG-3)

  • Alexa Fluor® 700 anti-human CD223 (LAG-3)

  • Pacific Blue™ anti-human CD223 (LAG-3)

  • PE/Cyanine5 anti-human CD223 (LAG-3)

  • APC/Cyanine7 anti-human CD223 (LAG-3)

  • APC/Fire™ 810 anti-human CD223 (LAG-3)

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account