TotalSeq™-D0032 anti-human CD154 Antibody

Pricing & Availability
24-31 (See other available formats)
Regulatory Status
Other Names
CD40L, gp39, TRAP, T-BAM, TNFSF5
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
310853 10 µg 287€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD154 (CD40 ligand) is also known as CD40L, gp39, TRAP and T-BAM. CD40 ligand is a 32-39 kD type II transmembrane glycoprotein. It is a member of the TNF superfamily and is expressed on activated T cells. It has been reported to be important for B cell costimulation following binding of its receptor, CD40. Additionally, binding of CD40L to CD40 on B cells promotes the secretion of immunoglobulin and Ig isotype switching. CD40L is also involved in the regulation of cytokine production by T cells.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Reported Reactivity
Cynomolgus, Rhesus
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunofluorescence microscopy1,3 and blocking of T cell-dependent B cell differentiation1,2,4,5. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 310812). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 310828) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Brams P, et al. 2001. Int. Immunopharmacol. 1:277. (Block, IF)
  2. Rushworth SA, et al. 2002. Transplantation 73:635. (Block)
  3. Berner B, et al. 2000. Ann. Rheum. Dis. 59:190. (IF)
  4. Nordström T, et al. 2006. J. Leukocyte Biol. 79:319. (Block)
  5. Zhang AL, et al.2007. Blood doi:10.1182/blood-2007-02-076364. (Block) PubMed
  6. Kuchen S, et al. 2007. J. Immunol. 179:5886.
  7. Matus-Nicodermos R, et al. 2011. J. Immunol. 186:2164. PubMed
  8. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
AB_2894564 (BioLegend Cat. No. 310853)

Antigen Details

TNF superfamily, type II transmembrane glycoprotein, cleaved as soluble CD40L, 32-39 kD

Activated T cells

B cell costimulation
Cell Type
T cells, Tregs
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Najafian N, et al. 2003. Expert Opin. Biol. Ther. 3:227.
2. Racke M, et al. 2002. Expert Opin. Ther. Targets. 6:275.
3. Ford G, et al. 1999. J. Immunol. 162:4037.

Gene ID
959 View all products for this Gene ID
View information about CD154 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 08/04/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD154

  • FITC anti-human CD154

  • PE anti-human CD154

  • PE/Cyanine5 anti-human CD154

  • APC anti-human CD154

  • Biotin anti-human CD154

  • Alexa Fluor® 488 anti-human CD154

  • Alexa Fluor® 647 anti-human CD154

  • Pacific Blue™ anti-human CD154

  • Brilliant Violet 785™ anti-human CD154

  • APC/Cyanine7 anti-human CD154

  • Brilliant Violet 421™ anti-human CD154

  • Brilliant Violet 605™ anti-human CD154

  • Ultra-LEAF™ Purified anti-human CD154

  • Brilliant Violet 510™ anti-human CD154

  • PE/Cyanine7 anti-human CD154

  • PerCP/Cyanine5.5 anti-human CD154

  • Brilliant Violet 711™ anti-human CD154

  • Purified anti-human CD154 (Maxpar® Ready)

  • PE/Dazzle™ 594 anti-human CD154

  • TotalSeq™-A0032 anti-human CD154

  • Alexa Fluor® 700 anti-human CD154

  • APC/Fire™ 750 anti-human CD154

  • TotalSeq™-C0032 anti-human CD154

  • TotalSeq™-B0032 anti-human CD154

  • TotalSeq™-D0032 anti-human CD154


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account