Loading...

TotalSeq™-D0023 anti-human CD155 (PVR) Antibody

Pricing & Availability
Clone
SKII.4 (See other available formats)
Regulatory Status
RUO
Other Names
Poliovirus receptor (PVR), nectin-like 5
Isotype
Mouse IgG1, κ
Barcode Sequence
ATCACATCGTTGCCA
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Quantity Check Availability Save
337639 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD155, known as poliovirus receptor (PVR) or nectin-like 5, is a 70 kD type I transmembrane glycoprotein. It is a nectin-like molecule belonging to Ig superfamily. CD155 is primarily found on endothelial cells, monocytes, epithelia and central nervous system. CD155 is an adhesion molecule involved in cell-cell and cell-matrix adhesion through interaction with CD226, CD96 (Tactile), nectin-1, -2, and -3 (CD111, CD112, CD113), and vitronectin. It also serves as a receptor for poliovirus and cytomegalovirus.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
SK-N-S1 human neuroblastoma cells.
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications include: block binding of PVR ligands CD226 and CD96 to PVR, immunoprecipitation, and western blot.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Fuchs A, et al. 2004. J. Immunol. 172:3994
RRID
AB_2892409 (BioLegend Cat. No. 337639)

Antigen Details

Structure
Type I glycoprotein, Ig superfamily
Distribution

Monocytes, endothelial cells, epithelia, central nervous system

Function
Cell-cell and cell-matrix adhesion
Ligand/Receptor
CD226, CD96, nectin-1, -2, and -3, vitronectin, CD155, poliovirus
Cell Type
Endothelial cells, Epithelial cells, Monocytes, Tregs
Biology Area
Immunology, Innate Immunity
Molecular Family
Adhesion Molecules, CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Zola H, et al. eds. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. Wiely-Liss A John Wiley & Sons Inc, Publication
2. Bottino PD, et al. 2005. Mol. Immunol. 42:463
3. Tahara-Hanaoka S, et al. 2004. Intl. Immunol. 16:533

Gene ID
5817 View all products for this Gene ID
UniProt
View information about CD155 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05/24/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • PE anti-human CD155 (PVR)

  • Purified anti-human CD155 (PVR)

  • PerCP/Cyanine5.5 anti-human CD155 (PVR)

  • PE/Cyanine7 anti-human CD155 (PVR)

  • PE/Dazzle™ 594 anti-human CD155 (PVR)

  • APC anti-human CD155 (PVR)

  • Alexa Fluor® 647 anti-human CD155 (PVR)

  • Biotin anti-human CD155 (PVR)

  • TotalSeq™-A0023 anti-human CD155 (PVR)

  • APC/Fire™ 750 anti-human CD155 (PVR)

  • Brilliant Violet 510™ anti-human CD155 (PVR)

  • Brilliant Violet 421™ anti-human CD155 (PVR)

  • FITC anti-human CD155 (PVR)

  • Alexa Fluor® 700 anti-human CD155 (PVR)

  • TotalSeq™-B0023 anti-human CD155 (PVR)

  • TotalSeq™-C0023 anti-human CD155 (PVR)

  • TotalSeq™-D0023 anti-human CD155 (PVR)

ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account