TotalSeq™-D0898 anti-human Ig light chain λ Antibody

Pricing & Availability
Clone
MHL-38 (See other available formats)
Regulatory Status
RUO
Other Names
Immunoglobulin light chain lambda
Isotype
Mouse IgG2a, κ
Barcode Sequence
CAGCCAGTAAGTCAC
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
316637 10 µg £253
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

The MHL-38 antibody reacts with both soluble and membrane human immunoglobulin light chain lambda (λ). It does not react with human immunoglobulin light chain kappa (κ) or heavy chains. The MHL-38 antibody can be used as primary or secondary reagent for immunofluorescent staining or ELISA analysis.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human Ig cocktail
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

 

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone MHL-38 is not compatible with Human TruStain FcX (Fc Receptor Blocking Solution) (Cat. No. 422301 & 422302).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID
AB_2922550 (BioLegend Cat. No. 316637)

Antigen Details

Structure
Ig family
Distribution

B cells

Cell Type
B cells
Biology Area
Immunology
Gene ID
3535 View all products for this Gene ID
UniProt
View information about Ig light chain lambda on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 03/18/2022

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human Ig light chain λ

  • Biotin anti-human Ig light chain λ

  • FITC anti-human Ig light chain λ

  • PE anti-human Ig light chain λ

  • APC anti-human Ig light chain λ

  • Alexa Fluor® 488 anti-human Ig light chain λ

  • Alexa Fluor® 647 anti-human Ig light chain λ

  • Pacific Blue™ anti-human Ig light chain λ

  • PerCP/Cyanine5.5 anti-human Ig light chain λ

  • Purified anti-human Ig light chain λ (Maxpar® Ready)

  • PE/Dazzle™ 594 anti-human Ig light chain λ

  • PE/Cyanine7 anti-human Ig light chain λ

  • APC/Fire™ 750 anti-human Ig light chain λ

  • TotalSeq™-A0898 anti-human Ig light chain λ

  • TotalSeq™-C0898 anti-human Ig light chain λ

  • Alexa Fluor® 700 anti-human Ig light chain λ

  • TotalSeq™-B0898 anti-human Ig light chain λ

  • APC/Cyanine7 anti-human Ig light chain λ

  • TotalSeq™-D0898 anti-human Ig light chain λ

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account