TotalSeq™-D0176 anti-human CD39 Antibody

Pricing & Availability
A1 (See other available formats)
Regulatory Status
HCDM listed
Other Names
gp80, E-ATPDase, NTPDase-1, ecto-apyrase, Ec3.6.1.5
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
328243 10 µg £222.00
Check Availability

Need larger quantities of this item?
Request Bulk Quote

Human CD39 is an integral membrane protein with two transmembrane domains. It exists as a homotetramer. Expression of CD39 is found on activated lymphocytes, a subset of T cells and B cells, and dendritic cells with weak staining on monocytes and granulocytes. CD39 and CD73 have been found on regulatory T cells, specifically the effector/memory like T cells. CD39 can hydrolyze both nucleoside triphosphates and diphosphates. CD39 is the dominant ecto nucleotidase of vascular and placental trophoblastic tissues and appears to modulate the functional expression of type 2 purinergic (P2) G protein coupled receptors (GPCRs). CD39 has intrinsic ecto-ATPase activity. Expression of CD39 is induced on T cells and increased on B cells as a late activation antigen.

Product Details
Technical Data Sheet (pdf)

Product Details

Human, Rhesus
Antibody Type
Host Species
PHA activated human lymphocytes
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The A1 antibody binds to the human CD39 cell surface antigen and has been shown to block MHC independent target cell recognition by hapten-specific CTL. Additional reported applications (for the relevant formats) include: in vitro CD39 blockade3,  immunofluorescence4, and immunohistochemistry6. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for blocking assays (contact our custom solutions team).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Aversa GG, et al. 1988. Transplant. P. 20:4952.
  2. Aversa GG, et al. 1989. Transplant. P. 21:34950.
  3. Borsellino G, et al. 2007. Blood. 110:1225. (Block)
  4. Stockl J, et al. 2001. J. Immunol. 167:2724. (IF)
  5. Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21.
  6. Lyck L, et al. 2008. J. Histochem. Cytochem. 56:201. (IHC)
AB_2892394 (BioLegend Cat. No. 328243)

Antigen Details


Activated lymphocytes, and also on a subset of T cells, regulatory T cells, B cells, and dendritic cells.

Cell Type
B cells, Dendritic cells, Lymphocytes, T cells, Tregs
Biology Area
Molecular Family
CD Molecules
Gene ID
953 View all products for this Gene ID
View information about CD39 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05/25/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Insert Note Here
Save Close Clear
Lab Timer
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account