- Clone
- L161 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V T-CD01.18
- Other Names
- R7, M241, BDCA-1
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GAGCTACTTCACTCG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
331551 | 10 µg | £253 |
CD1c, also known as R7 or M241, is a 43 kD member of the five CD1 antigens (CD1a-e) in humans. The CD1 molecules are type I glycoprotein with structural similarities to MHC class I and are non-covalently associated with β2-microglobulin, belonging to the Ig superfamily. CD1c is expressed on cortical thymocytes, Langerhans cells, dendritic cells, and a subset of B cells. It has been reported that CD1c is also expressed on mature T cells in a tightly regulated manner. CD1c is involved in antigen-presentation of glycolipids. It may also act in T cells as an immune regulatory molecule.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemical staining on frozen tissue4, 5, formalin-fixed paraffin-embedded immunohistochemical staining6, and spatial biology (IBEX)7,8.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- del C Salamone M, et al. 2001. J Leukoc Biol. 70:567.
- de Fraissinette A, et al. 1988. Exp Hematol. 16:764.
- Li D, et al. 2012. J Exp Med. 209:109. PubMed
- Xu C, et al. 2010. Am J Hematol. 85:539 (IHC-F)
- Gerlini G, et al. 2001. J Invest Dermatol. 117:576 (IHC-F)
- Poposki J, et al. 2016. Clin Exp Allergy 45:384 (IHC-P) PubMed
- Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- RRID
-
AB_2892400 (BioLegend Cat. No. 331551)
Antigen Details
- Structure
- 43 kD, Ig superfamily, MHC I-like molecule, associates with β2-microglobulin
- Distribution
-
B cell subset, cortical thymocytes, dendritic cells, and Langerhans cells
- Function
- Presents lipid antigen to CD1c-restricted T cells
- Ligand/Receptor
- CD1c-restricted TCR
- Cell Type
- B cells, Dendritic cells, Langerhans cells, Thymocytes
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Fainboim LM and del C. Salamone. 2002. J. Biol. Reg. Homeos. Ag. 16:125.
2. M. del Salamone C, et al. 2001. J. Leukocyte Biol. 70:567.
3. Zola H, et al. Eds. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. P42. - Gene ID
- 911 View all products for this Gene ID
- UniProt
- View information about CD1c on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD1c Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PerCP anti-human CD1c
-
Purified anti-human CD1c
-
Biotin anti-human CD1c
-
PE anti-human CD1c
-
Pacific Blue™ anti-human CD1c
-
Alexa Fluor® 647 anti-human CD1c
-
PerCP/Cyanine5.5 anti-human CD1c
-
Brilliant Violet 421™ anti-human CD1c
-
PE/Cyanine7 anti-human CD1c
-
FITC anti-human CD1c
-
APC/Cyanine7 anti-human CD1c
-
APC anti-human CD1c
-
Alexa Fluor® 488 anti-human CD1c
-
Alexa Fluor® 700 anti-human CD1c
-
PE/Dazzle™ 594 anti-human CD1c
-
Brilliant Violet 510™ anti-human CD1c
-
Brilliant Violet 605™ anti-human CD1c
-
Brilliant Violet 711™ anti-human CD1c
-
TotalSeq™-A0160 anti-human CD1c
-
Brilliant Violet 650™ anti-human CD1c
-
Brilliant Violet 785™ anti-human CD1c
-
APC/Fire™ 750 anti-human CD1c
-
TotalSeq™-C0160 anti-human CD1c
-
TotalSeq™-B0160 anti-human CD1c
-
TotalSeq™-D0160 anti-human CD1c
-
PE/Cyanine5 anti-human CD1c
Follow Us