TotalSeq™-D0151 anti-human CD152 (CTLA-4) Antibody

Pricing & Availability
BNI3 (See other available formats)
Regulatory Status
Other Names
CTLA4, Cytotoxic T-Lymphocyte Antigen 4, CTLA-4
Mouse IgG2a, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
369635 10 µg £222.00
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD152, also known as Cytotoxic T-Lymphocyte Antigen 4 (CTLA-4), is a 33 kD member of the immunoglobulin superfamily. It is transiently expressed on activated T cells. CTLA-4 is expressed on the surface of helper T cells and transmits an inhibitory signal to T cells. Regulatory T cells express high levels of CTLA-4. CTLA-4 (CD152) is similar to CD28 in amino acid sequence, structure, and genomic organization. Whereas CD28 delivers a costimulatory signal in T cell activation, CTLA-4 negatively regulates cell-mediated immune responses through interaction with CD80 (B7-1) and CD86 (B7-2) present on antigen presenting cells (APC). CTLA-4 is thought to play a role in the induction and maintenance of immunological tolerance as well as the development of protective immunity and thymocyte regulation.

Mutations in the CTLA-4 gene have been associated with various autoimmune diseases, such as systemic lupus erythematosus, insulin-dependent diabetes mellitus, and other autoimmune diseases. A transcript of the CTLA-4 gene that may represent a native soluble form of CTLA-4 (sCTLA-4) showed that eleven of twenty patients with autoimmune thyroid disease (ATD) had a high concentration of sCTLA-4, whereas only 1 of 30 apparently healthy volunteers contained measurable levels. sCTLA-4 immunoreactivity was inhibited by its binding to B7.1, suggesting that sCTLA-4 is a functional receptor. sCTLA-4 also plays a role in the initial immune response to infection of immune cells by HIV, along with the CD-1 pathway and others.

Product Details
Technical Data Sheet (pdf)

Product Details

Antibody Type
Host Species
Extracellular domain of human CTLA-4 and constant regions of the human IgG heavy chain (CTLA-4/IgG)
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Based on in-house testing, we do not recommend using clone BNI3 for immunohistochemistry of paraffin-embedded tissue section.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Linsley PS, et al. 1992. J. Exp. Med. 176:1595.
  2. Bonzheim I, et al. 2008. Am. J. Clin. Pathol. 130:613.
Product Citations
AB_2894575 (BioLegend Cat. No. 369635)

Antigen Details

Ig superfamily and 33 kD.

Activated T cells and B cells.

Negative regulator of T cell activation.
Antigen presenting cells, such as dendritic cells.
B7-1 (CD80), B7-2 (CD86).
Cell Type
B cells, T cells
Biology Area
Immunology, Inhibitory Molecules
Molecular Family
CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Kuiper HM, et al. 1995. J. Immunol. 155:1776.
2. Castan J, et al. 1997. Immunology 90:265.
3. Lee CC, et al. 2009. Pediatr. Allergy Immunol. 20:624.
4. Pistillo MP, et al. 2003. Blood 101:202.
5. Tan PH, et al. 2005. Blood. 106:2936.
6. Steiner K, et al. 2001. Clin. Exp. Immunol. 126:143.

Gene ID
1493 View all products for this Gene ID
View information about CD152 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 08/12/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Insert Note Here
Save Close Clear
Lab Timer
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account