TotalSeq™-D0140 anti-human CD183 (CXCR3) Antibody

Pricing & Availability
Clone
G025H7 (See other available formats)
Regulatory Status
RUO
Other Names
CXCR3, G protein-coupled receptor 9 (GPR9), CKR-L2
Isotype
Mouse IgG1, κ
Barcode Sequence
GCGATGGTAGATTAT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
353757 10 µg £253
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Human CXCR3, also known as GPR9, is a chemokine receptor that binds CXCL9, CXCL10, and CXCL11. It is a 38 kD seven-pass transmembrane receptor coupled to G-protein. CXCR3 is highly expressed by T cells (Th1), natural killer cells (NK cells), dendritic cells, mast cells, alveolar macrophages, eosinophils, and human airway epithelial cells. CXCR3 is important for effector lymphocyte recruitment into inflamed tissue in various inflammatory and autoimmune diseases, such as chronically inflamed liver, Crohn's disease, rheumatoid arthritis, multiple sclerosis, and inflammatory skin diseases.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human CXCR3 transfectants
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID
AB_2894580 (BioLegend Cat. No. 353757)

Antigen Details

Structure
CXC-chemokine receptor, G protein-coupled receptor, seven-pass transmembrane receptor
Distribution

T cell subset, NK cells, plasmacytoid dendritic cells, GM-CSF activated CD34+ hematopoietic progenitors, mast cells, alveolar macrophages, eosinophils, and airway epithelial cells

Function
Essential in T cell recruitment to sites of inflammation
Ligand/Receptor
CXCL9, CXCL10, and CXCL11
Cell Type
Dendritic cells, Eosinophils, Epithelial cells, Hematopoietic stem and progenitors, Macrophages, Mast cells, NK cells, T cells, Tregs
Biology Area
Cell Biology, Immunology, Neuroinflammation, Neuroscience
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors, GPCR
Antigen References

1. Loetscher M, et al. 1996. J. Exp. Med. 184:963.
2. Cole KE, et al. 1998. J. Exp. Med. 187:2009.
3. Aksoy MO, et al. 2006. Am. J. Physiol. Lung Cell Mol. Physiol. 290:L909.
4. Curbishley SM, et al. 2005. Am. J. Pathol. 167:887.
5. Turner JE, et al. 2007. Mini. Rev. Med. Chem. 7:1089.
6. Wenzel J, et al. 2008. J. Invest. Dermatol. 128:67.

Gene ID
2833 View all products for this Gene ID
UniProt
View information about CD183 on UniProt.org

Related FAQs

Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?

Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.

Other Formats

View All CD183 Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD183 (CXCR3) G025H7 FC
APC/Cyanine7 anti-human CD183 (CXCR3) G025H7 FC
FITC anti-human CD183 (CXCR3) G025H7 FC
PE anti-human CD183 (CXCR3) G025H7 FC
APC anti-human CD183 (CXCR3) G025H7 FC
Alexa Fluor® 488 anti-human CD183 (CXCR3) G025H7 FC
Alexa Fluor® 647 anti-human CD183 (CXCR3) G025H7 FC
PerCP/Cyanine5.5 anti-human CD183 (CXCR3) G025H7 FC
Brilliant Violet 421™ anti-human CD183 (CXCR3) G025H7 FC
PE/Cyanine7 anti-human CD183 (CXCR3) G025H7 FC
Pacific Blue™ anti-human CD183 (CXCR3) G025H7 FC
Brilliant Violet 510™ anti-human CD183 (CXCR3) G025H7 FC
Brilliant Violet 605™ anti-human CD183 (CXCR3) G025H7 FC
Brilliant Violet 650™ anti-human CD183 (CXCR3) G025H7 FC
Brilliant Violet 711™ anti-human CD183 (CXCR3) G025H7 FC
Purified anti-human CD183 (CXCR3) (Maxpar® Ready) G025H7 FC,CyTOF®
PE/Dazzle™ 594 anti-human CD183 (CXCR3) G025H7 FC
PerCP anti-human CD183 (CXCR3) G025H7 FC
Brilliant Violet 785™ anti-human CD183 (CXCR3) G025H7 FC
Alexa Fluor® 700 anti-human CD183 (CXCR3) G025H7 FC
Biotin anti-human CD183 (CXCR3) G025H7 FC
TotalSeq™-A0140 anti-human CD183 (CXCR3) G025H7 PG
TotalSeq™-C0140 anti-human CD183 (CXCR3) G025H7 PG
Ultra-LEAF™ Purified anti-human CD183 (CXCR3) G025H7 Block,FC
TotalSeq™-B0140 anti-human CD183 (CXCR3) G025H7 PG
APC/Fire™ 750 anti-human CD183 (CXCR3) G025H7 FC
TotalSeq™-D0140 anti-human CD183 (CXCR3) G025H7 PG
PE/Fire™ 810 anti-human CD183 (CXCR3) Antibody G025H7 FC
APC/Fire™ 810 anti-human CD183 (CXCR3) Antibody G025H7 FC
PE/Cyanine5 anti-human CD183 (CXCR3) Antibody G025H7 FC
PE/Fire™ 640 anti-human CD183 (CXCR3) G025H7 FC
PerCP/Fire™ 780 anti-human CD183 (CXCR3) G025H7 FC
Go To Top Version: 1    Revision Date: 07/07/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD183 (CXCR3)

  • APC/Cyanine7 anti-human CD183 (CXCR3)

  • FITC anti-human CD183 (CXCR3)

  • PE anti-human CD183 (CXCR3)

  • APC anti-human CD183 (CXCR3)

  • Alexa Fluor® 488 anti-human CD183 (CXCR3)

  • Alexa Fluor® 647 anti-human CD183 (CXCR3)

  • PerCP/Cyanine5.5 anti-human CD183 (CXCR3)

  • Brilliant Violet 421™ anti-human CD183 (CXCR3)

  • PE/Cyanine7 anti-human CD183 (CXCR3)

  • Pacific Blue™ anti-human CD183 (CXCR3)

  • Brilliant Violet 510™ anti-human CD183 (CXCR3)

  • Brilliant Violet 605™ anti-human CD183 (CXCR3)

  • Brilliant Violet 650™ anti-human CD183 (CXCR3)

  • Brilliant Violet 711™ anti-human CD183 (CXCR3)

  • Purified anti-human CD183 (CXCR3) (Maxpar® Ready)

  • PE/Dazzle™ 594 anti-human CD183 (CXCR3)

  • PerCP anti-human CD183 (CXCR3)

  • Brilliant Violet 785™ anti-human CD183 (CXCR3)

  • Alexa Fluor® 700 anti-human CD183 (CXCR3)

  • Biotin anti-human CD183 (CXCR3)

  • TotalSeq™-A0140 anti-human CD183 (CXCR3)

  • TotalSeq™-C0140 anti-human CD183 (CXCR3)

  • Ultra-LEAF™ Purified anti-human CD183 (CXCR3)

  • TotalSeq™-B0140 anti-human CD183 (CXCR3)

  • APC/Fire™ 750 anti-human CD183 (CXCR3)

  • TotalSeq™-D0140 anti-human CD183 (CXCR3)

  • PE/Fire™ 810 anti-human CD183 (CXCR3) Antibody

  • APC/Fire™ 810 anti-human CD183 (CXCR3) Antibody

  • PE/Cyanine5 anti-human CD183 (CXCR3) Antibody

  • PE/Fire™ 640 anti-human CD183 (CXCR3)

  • PerCP/Fire™ 780 anti-human CD183 (CXCR3)

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account