TotalSeq™-D0136 anti-human IgM Antibody

Pricing & Availability
MHM-88 (See other available formats)
Regulatory Status
Other Names
Immunoglobulin M
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
314553 10 µg £253
Check Availability

Need larger quantities of this item?
Request Bulk Quote

IgM is the first immunoglobulin made by B cells in the immune response. Surface IgM is expressed on immature and mature B cells, while IgM heavy (μ) chain is expressed intracellularly in pre-B cells.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Host Species
Human Ig cocktail
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

MHM-88 antibody reacts with both soluble and membrane human immunoglobulin M (IgM). It does not react with other Ig isotypes. Additional reported applications (for the relevant formats) include: use as a primary or secondary reagent for ELISA analysis.

Due to the presence of excess soluble IgM in whole blood, which competes for antibody binding, staining for IgM on cells in whole blood is not recommended.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Perez-Shiyama C, et al. 2014. J Immunol. 192:5192. PubMed
AB_2922547 (BioLegend Cat. No. 314553)

Antigen Details

Ig family

B cells

B cell differentiation, humoral immune response; cross-linking surface IgM induces apoptosis
Cell Type
B cells
Biology Area
Gene ID
3507 View all products for this Gene ID
View information about IgM on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 03/18/2022

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human IgM

  • PE anti-human IgM

  • Biotin anti-human IgM

  • FITC anti-human IgM

  • APC anti-human IgM

  • PerCP/Cyanine5.5 anti-human IgM

  • Pacific Blue™ anti-human IgM

  • Brilliant Violet 421™ anti-human IgM

  • APC/Cyanine7 anti-human IgM

  • Brilliant Violet 570™ anti-human IgM

  • Brilliant Violet 510™ anti-human IgM

  • Brilliant Violet 605™ anti-human IgM

  • Brilliant Violet 650™ anti-human IgM

  • Purified anti-human IgM (Maxpar® Ready)

  • PE/Dazzle™ 594 anti-human IgM

  • PE/Cyanine7 anti-human IgM

  • Alexa Fluor® 488 anti-human IgM

  • Alexa Fluor® 647 anti-human IgM

  • Alexa Fluor® 700 anti-human IgM

  • Brilliant Violet 711™ anti-human IgM

  • TotalSeq™-A0136 anti-human IgM

  • TotalSeq™-C0136 anti-human IgM

  • Brilliant Violet 785™ anti-human IgM

  • APC/Fire™ 750 anti-human IgM

  • TotalSeq™-B0136 anti-human IgM

  • Spark Violet™ 423 anti-human IgM Antibody

  • TotalSeq™-D0136 anti-human IgM

  • Spark Blue™ 550 anti-human IgM


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account