TotalSeq™-D0055 anti-human CD138 (Syndecan-1) Antibody

Pricing & Availability
MI15 (See other available formats)
Regulatory Status
HCDM listed
Other Names
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
356545 10 µg £253
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD138, a member of the syndecan protein family, is a type I integral membrane heparin sulfate proteoglycan also known as Syndecan-1. Syndecan-1 participates in cell proliferation, cell migration, and cell-matrix adhesion via interaction with collagen, fibronectin, and other soluble molecules (such as FGF-basic). It is expressed on normal and malignant human plasma cells, pre-B cells, epithelial cells, and endothelial cells, but not on mature circulating B-lymphocytes. It is also expressed on some non-hematopoietic cells, including embryonic mesenchymal cells, vascular smooth muscle cells, endothelial cells, and neural cells.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Antibody Type
Host Species
A mixture of U266 and XG-1 human myeloma cell lines.
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The epitope recognized by MI15 is found within the ectodomain of the CD138 core protein. It has been reported that MI15 blocks the binding of clone B-B4 but not clone DL-101 by flow cytometric analysis. Clones DL-101 and MI15 exhibit differential staining patterns on in vitro generated plasma cells and some CD138+ cell lines.4

Additional reported applications for the relevant formats include: immunofluorescent staining1, Western blotting2, immunohistochemical staining of formalin-fixed paraffin-embedded frozen tissue sections3, and spatial biology (IBEX)5,6.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Costes V, et al. 1999. Hum. Pathol. 30:1405. (IF)
  2. Gattei V, et al. 1999. Br. J. Haematol. 104:152. (WB)
  3. Bologna-Molina R, et al. 2008. Oral Oncol. 44:805. (IHC)
  4. Itoua MR, et al. 2014. Biomed. Res. Int. 2014:536482.
  5. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  6. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
AB_2904378 (BioLegend Cat. No. 356545)

Antigen Details

100-200 kD type I integral transmembrane glycoprotein

Plasma cells, pre-B cells, epithelial cells, endothelial cells

Adhesion, controls cell morphology, regulates cell growth
FGFb, collagen, fibronectin
Cell Type
B cells, Endothelial cells, Epithelial cells, Plasma cells
Biology Area
Cell Adhesion, Cell Biology, Cell Motility/Cytoskeleton/Structure, Immunology, Neuroscience, Synaptic Biology
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Sanderson RD, et al. 1992. Cell. Regul. 1:27.
2. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules: The CD Markers. Wiley-Liss A John Wiley & Sons Inc, Publication.

Gene ID
6382 View all products for this Gene ID
View information about CD138 on

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD138 Reagents Request Custom Conjugation
Description Clone Applications
PE anti-human CD138 (Syndecan-1) MI15 FC, SB
Purified anti-human CD138 (Syndecan-1) MI15 FC, ICC, WB, IHC-P
APC anti-human CD138 (Syndecan-1) MI15 FC
FITC anti-human CD138 (Syndecan-1) MI15 FC
PerCP/Cyanine5.5 anti-human CD138 (Syndecan-1) MI15 FC
Alexa Fluor® 700 anti-human CD138 (Syndecan-1) MI15 FC
PE/Cyanine7 anti-human CD138 (Syndecan-1) MI15 FC
Brilliant Violet 421™ anti-human CD138 (Syndecan-1) MI15 FC
Brilliant Violet 510™ anti-human CD138 (Syndecan-1) MI15 FC
Brilliant Violet 605™ anti-human CD138 (Syndecan-1) MI15 FC
Brilliant Violet 711™ anti-human CD138 (Syndecan-1) MI15 FC
Alexa Fluor® 647 anti-human CD138 (Syndecan-1) MI15 FC, SB
Alexa Fluor® 594 anti-human CD138 (Syndecan-1) MI15 ICC
PE/Dazzle™ 594 anti-human CD138 (Syndecan-1) MI15 FC
APC/Cyanine7 anti-human CD138 (Syndecan-1) MI15 FC
Pacific Blue™ anti-human CD138 (Syndecan-1) MI15 FC
TotalSeq™-A0055 anti-human CD138 (Syndecan-1) MI15 PG
Brilliant Violet 785™ anti-human CD138 (Syndecan-1) MI15 FC
Biotin anti-human CD138 (Syndecan-1) MI15 FC
TotalSeq™-C0055 anti-human CD138 (Syndecan-1) MI15 PG
APC/Fire™ 750 anti-human CD138 (Syndecan-1) MI15 FC
TotalSeq™-B0055 anti-human CD138 (Syndecan-1) MI15 PG
PE/Cyanine5 anti-human CD138 (Syndecan-1) MI15 FC
TotalSeq™-D0055 anti-human CD138 (Syndecan-1) MI15 PG
PE/Fire™ 640 anti-human CD138 (Syndecan-1) MI15 FC
Spark Violet™ 500 anti-human CD138 (Syndecan-1) MI15 FC
Go To Top Version: 1    Revision Date: 12/14/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • PE anti-human CD138 (Syndecan-1)

  • Purified anti-human CD138 (Syndecan-1)

  • APC anti-human CD138 (Syndecan-1)

  • FITC anti-human CD138 (Syndecan-1)

  • PerCP/Cyanine5.5 anti-human CD138 (Syndecan-1)

  • Alexa Fluor® 700 anti-human CD138 (Syndecan-1)

  • PE/Cyanine7 anti-human CD138 (Syndecan-1)

  • Brilliant Violet 421™ anti-human CD138 (Syndecan-1)

  • Brilliant Violet 510™ anti-human CD138 (Syndecan-1)

  • Brilliant Violet 605™ anti-human CD138 (Syndecan-1)

  • Brilliant Violet 711™ anti-human CD138 (Syndecan-1)

  • Alexa Fluor® 647 anti-human CD138 (Syndecan-1)

  • Alexa Fluor® 594 anti-human CD138 (Syndecan-1)

  • PE/Dazzle™ 594 anti-human CD138 (Syndecan-1)

  • APC/Cyanine7 anti-human CD138 (Syndecan-1)

  • Pacific Blue™ anti-human CD138 (Syndecan-1)

  • TotalSeq™-A0055 anti-human CD138 (Syndecan-1)

  • Brilliant Violet 785™ anti-human CD138 (Syndecan-1)

  • Biotin anti-human CD138 (Syndecan-1)

  • TotalSeq™-C0055 anti-human CD138 (Syndecan-1)

  • APC/Fire™ 750 anti-human CD138 (Syndecan-1)

  • TotalSeq™-B0055 anti-human CD138 (Syndecan-1)

  • PE/Cyanine5 anti-human CD138 (Syndecan-1)

  • TotalSeq™-D0055 anti-human CD138 (Syndecan-1)

  • PE/Fire™ 640 anti-human CD138 (Syndecan-1)

  • Spark Violet™ 500 anti-human CD138 (Syndecan-1)


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account