TotalSeq™-A0594 anti-human CD133 Antibody

Pricing & Availability
Clone
S16016B (See other available formats)
Other Names
Prominin-1, PROM1, AC133
Isotype
Mouse IgG2a, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
394005 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD133, also known as Prominin-1 and AC133 antigen, is a 120 kD pentaspan glycoprotein with 5 transmembrane domains. CD133 was initially described as a surface antigen specific for human hematopoietic stem cells and as a marker for murine neuroepithelial cells and some embryonic epithelia. Later on, CD133 was found on other stem cells, including endothelial progenitor cells, glioblastomas, neuronal, and glial stem cells. In addition to stem cells for normal tissue, CD133 was found on cancer cells, such as some leukemia cells and brain tumor cells. Although the biological function of CD133 is not completely understood, CD133 has been extensively used as a stem cell marker for normal and cancerous tissues.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human CD133 Transfectants
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

In-house testing suggests that clone S16016B blocks clone AC133 but not clone 7 that are also raised against human CD133

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone S16016B is GTAAGACGCCTATGC .

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the poly A tail, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, where B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [GTAAGACGCCTATGC]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

RRID
AB_2783304 (BioLegend Cat. No. 394005)

Antigen Details

Structure
120 kD pentaspan transmembrance glycoprotein with 5 transmembrane domains.
Distribution

Hematopoietic stem cells and progenitor cells, fetal liver cells, tissue specific stem cells or progenitor cells such as renal and prostate, a variety of tumor cells.

Function
May play a role in cell differentiation, proliferation, and apoptosis.
Interaction
NAT8; NAT8B; CDHR1
Cell Type
Hematopoietic stem and progenitors
Biology Area
Cancer Biomarkers, Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules
Antigen References
  1. Yin AH, et al. 1997. Blood. 90:5002.
  2. Miraglia S, et al. 1997. Blood. 90:5013.
  3. Bühring HJ, et al. 1999. Ann. NY Acad. Sci. 872:25.
Gene ID
8842 View all products for this Gene ID
UniProt
View information about CD133 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/05/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account