TotalSeq™-A0569 anti-human CD338 (ABCG2) Antibody

Pricing & Availability
Clone
5D3 (See other available formats)
Workshop
HCDM listed
Other Names
ABCG2, CDw338, Bcrp1, MXR
Isotype
Mouse IgG2b, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
332021 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD338, known as ABCG2 (BCRP1), is a multi-drug resistance (MDR) family protein that is a member of ATP binding cassette (ABC) transporters. It is highly expressed on primitive ‘side population’ (SP) stem cells. This SP phenotype is based on the efflux of fluorescent dyes such as Rhodamine 123 and Hoechst 33342. The SP cells express low or undetectable levels of CD34.  In the bone marrow, about 0.05% population of cells displays the low fluorescence and are highly enriched for repopulating cells.  The highest levels of BCRP1 mRNA expression have been seen in KDR+ human stem cells.  The expression of ABCG2 appears to be highly conserved as it has been identified in various species.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

This clone is listed under the following US Patent Numbers:
6,313,277; 7,541,437; 7,655,755; 7,741,455

Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical supportfor more information, or visit biolegend.com/totalseq.

 

The TotalSeq™-A barcode sequence associated with clone 5D3 is TAAGACTTGGCCGTC.

 

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the poly A tail, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, where B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

 

The full oligomer sequence for this product, with the specific barcode in brackets is  CCTTGGCACCCGAGAATTCCA [TAAGACTTGGCCGTC]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Matalia H, 2012. Br J Ophthalmol. PubMed
  2. 2. Zhou S, et al. 2001. Nat. Med. 7:1028. (FC)
  3. Abbott BL, et al. 2002. Blood 100:4594. (FC)
  4. Huang FF, et al. 2104. PloS One. 9:88298. PubMed
RRID
AB_2783216 (BioLegend Cat. No. 332021)

Antigen Details

Distribution

primitive 'sidepopulation' (SP) stem cells, KDR+ human stem cells

Cell Type
Embryonic Stem Cells, Neural Stem Cells
Biology Area
Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family
CD Molecules
Antigen References

1. Kim M, et al. 2002. Clin. Cancer Res. 8:228.
2. Scharenber CW, et al. 2002. Blood 99:50712.
3.Goodell MA, et al. 1997. Nat. Med. 3:133745.
4. Bunting KD. 2002. Stem Cells. 20:11.

Gene ID
9429 View all products for this Gene ID
UniProt
View information about CD338 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/27/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account