TotalSeq™-A0567 anti-mouse Tim-4 Antibody

Pricing & Availability
Clone
RMT4-54 (See other available formats)
Other Names
T cell immunoglobulin and mucin domain containing protein-4
Isotype
Rat IgG2a, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
130011 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Tim-4 is a transmembrane protein known as T cell immunoglobulin and mucin domain containing protein-4. It is expressed on antigen-presenting cells and not on T cells. Tim-4 binds to Tim-1 to promote T cell proliferation by enhancing cell division and reducing apoptosis. Tim-4 bind to phosphatidylserine through its FG-CC’ binding cleft in the N-terminal IgV domain to facilitate the clearance of apoptotic cells or bodies.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse TIM4-Ig fusion protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats of this clone) include: in vivo induction of auto-antibody production1 and blockade of dendritic cell Tim-42.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical supportfor more information, or visit biolegend.com/totalseq.

 

The TotalSeq™-A barcode sequence associated with clone RMT4-54 is TGCTGGAGGGTATTC.

 

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the poly A tail, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, where B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

 

The full oligomer sequence for this product, with the specific barcode in brackets is  CCTTGGCACCCGAGAATTCCA [TGCTGGAGGGTATTC]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Nakayama M, et al. 2009. Blood. 113:3821. (FA)
  2. Yeung MY, et al. 2013. J. Immunol. 191:4447. (Block)
RRID
AB_2783084 (BioLegend Cat. No. 130011)

Antigen Details

Structure
Transmembrane protein containing immunoglobulin domain and mucin-like domain
Distribution

Unlike the other Tims, Tim-4 is only expressed by antigen-presenting cells, but not by T cells.

Function
Tim-4 is expressed on antigen-presenting cells. It provides co-stimulation to promote T cell proliferation and survival and has a possible role in clearance of apoptotic cells by binding phosphatidylserine.
Interaction
Phosphatiylserine is the ligand of Tim-4 and Tim-4 is a ligand of Tim-1.
Ligand Receptor
Phosphatidylserine, TIM1
Biology Area
Immunology
Antigen References

1. Kuchroo VK, et al. 2008. Nat. Rev. Immunol. 8:577
2. Miyanishi M, et al. 2007. Nature 450:435
3. Rodriguez-Manzanet R, et al. 2008. J. Immunol. 180:4706

Gene ID
276891 View all products for this Gene ID
UniProt
View information about Tim-4 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/27/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account