TotalSeq™-A0563 anti-mouse CX3CR1 Antibody

Pricing & Availability
SA011F11 (See other available formats)
Other Names
Chemokine (C-X3-C motif) receptor 1, Fractalkine receptor, GPR13, CCRL1, CMKBRL1, CMKDR1, V28
Mouse IgG2a, κ
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Avail. Save
149041 10 µg £218
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CX3CR1 is a 40 kD, G-protein coupled receptor, with seven transmembrane regions. CX3CR1 is expressed by resident and alternatively activated macrophages (M2), a subset of monocytes, dendritic cells (DCs), NK cells, a subset of memory T cells, and mast cells. CX3CR1 is involved in cell recruitment during inflammation and participates in cell adhesion and extravasation from blood vessels. Its ligand is CX3CL1, also known as fractalkine or neurotactin. CX3CR1 is also a coreceptor for HIV1 and variations in this gene leads to increased susceptibility to HIV. In the brain, it is expressed by glial cells, which interact with CX3CL1 expressed by neurons.

Product Details
Technical Data Sheet (pdf)

Product Details

Antibody Type
Host Species
Mouse CX3CR1-transfected cells
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

For in vivo studies or highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 149011) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg).

View more applications data for a different format of this clone in our Scientific Poster Library.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The TotalSeq™-A barcode sequence associated with clone SA011F11 is CACTCTCAGTCCTAT.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the capture sequence, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [CACTCTCAGTCCTAT]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

AB_2783121 (BioLegend Cat. No. 149041)

Antigen Details

G-protein coupled receptor, 7 transmembrane regions, 40 kD.

Resident and alternatively activated macrophages (M2), subset of monocytes, dendritic cells (DCs), natural killer cells (NK), subset of memory T cells, mast cells, glial cells, and astrocytes.

Involved in cell recruitment during inflammation, participates in cell adhesion and extravasation from blood vessels, coreceptor for HIV1.
Ligand Receptor
CX3CL1 (fractalkine, neurotactin).
Cell Type
Astrocytes, Dendritic cells, Macrophages, Mast cells, Monocytes, NK cells, T cells
Biology Area
Cell Adhesion, Cell Biology, Immunology, Innate Immunity, Neuroscience, Neuroscience Cell Markers
Molecular Family
Cytokine/Chemokine Receptors
Antigen References

1. Ponzetta A, et al. 2013. J. Immunol. 191:5684.
2. Jacquelin S, et al. 2013. Blood. 122:674.
3. Garcia JA, et al. 2013. J. Immunol. 191:1063.
4. Lee YS, et al. 2013. Cell. 153:413.
5. Shechter R, et al. 2013. Immunity. 38:555.

Gene ID
13051 View all products for this Gene ID
View information about CX3CR1 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 10/15/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account