- Clone
- 1F8C33 (See other available formats)
- Other Names
- Msr1, MSR, SR-A, Scavenger receptor type A, Macrophage scavenger receptor I, Scara1
- Isotype
- Rat IgG2a
- Ave. Rating
- Submit a Review
- Product Citations
- publications
| Cat # | Size | Price | Quantity Avail. | Save | ||
|---|---|---|---|---|---|---|
| 154703 | 10 µg | £218 | ||||
CD204, also known as scavenger receptor A (SR-A) and the macrophage scavenger receptor (MSR), is 220 kDa, trimeric type II transmembrane protein, with one scavenger receptor cysteine-rich domain (SRCR). It is a phagocytic pattern-recognition receptor (PRR) expressed on macrophages and dendritic cells. CD204 is a receptor mediating recognition and internalization of low-density lipoprotein (LDL) by macrophages and plays a critical role in atherogenesis. CD204 also recognizes apoptotic cells, modified lipid proteins, and exogenous pathogen-associated molecular patterns (PAMPs), which results in the induction of innate immune and inflammatory responses. CD204 can act as a co-receptor for Toll-like receptors, such as TLR3, TLR4, or TLR9, to facilitate the expression of proinflammatory cytokines. CD204 has been implicated in several pathological processes such as Alzheimer’s disease, sepsis, ischemic injury, and coronary artery disease.
Product DetailsProduct Details
- Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Recombinant mouse CD204 extracellular domain
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.
To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
This clone has minimal recognition of CD204 in C57BL/6.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The TotalSeq™-A barcode sequence associated with clone 1F8C33 is AGCTAGACACGTTGT.
The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the poly A tail, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, where B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [AGCTAGACACGTTGT]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A. - RRID
-
AB_2783126 (BioLegend Cat. No. 154703)
Antigen Details
- Structure
- Trimeric type II transmembrane protein, one scavenger receptor cysteine-rich domain (SRCR), 220 kD.
- Distribution
-
Macrophages, dendritic cells.
- Function
- Uptake of negatively charged molecules, role in pathology of atherosclerosis and Alzheimer’s disease.
- Ligand Receptor
- Acetylated and oxidized lipoproteins
- Cell Type
- Dendritic cells, Macrophages
- Antigen References
-
- Shichita T, et al. 2017. Nat Med. 23:723.
- Muczynski V, et al. 2017. Blood. 129:2443.
- Iftakhar-E-Khuda I, et al. 2016. Proc Natl Acad Sci U S A. 113:10643.
- Nellimarla S, et al. 2015. J Immunol. 195:3858.
- Bonilla DL, et al. 2013. Immunity. 39:537.
- Gene ID
- 20288 View all products for this Gene ID
- UniProt
- View information about CD204 on UniProt.org
Related FAQs
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.