TotalSeq™-A0440 anti-mouse CD169 (Siglec-1) Antibody

Pricing & Availability
Clone
3D6.112 (See other available formats)
Other Names
Sialic acid binding Ig-like lectin 1 (Siglec-1), Sialoadhesin (Sn)
Isotype
Rat IgG2a, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
142425 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD169, also known as Siglec-1 and Sialoadhesin (Sn), is a type I lectin containing 17 immunoglobulin (Ig) domains (one variable domain and 16 constant domains). CD169 binds to sialic acids, which can be found on PSGL-1, CD43, CD206, and CD227. By its affinity to α2, 3-linked sialic acid, it is involved in macrophage binding to different cell types such as granulocytes, monocytes, NK, B, and T cells. CD169 was initially identified as a sialic acid-dependent sheep erythrocyte receptor (SER) on resident bone marrow cells of mice. It has been identified as highly expressed on resident bone marrow macrophages which plays an important role in retention of stem cells in mesenchymal stem cell niche. It is also found on some specific subsets of tissue macrophages in spleen, lymph nodes, bone marrow, liver, colon, lungs, and cancer cells. Evidence suggest that CD169-positive macrophages serve as lymph node-resident APCs to dominate early activation of tumor antigen-specific CD8+ T cells and invariant NK cell.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Purified Native Sialoadhesin from spleen
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining in frozen tissue sections1.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone 3D6.112 is ATTGACGACAGTCAT.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the poly A tail, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, where B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [ATTGACGACAGTCAT]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A

Application References

(PubMed link indicates BioLegend citation)
  1. Barral P, et al. 2010. Nat. Immunol. 11:303. (IHC-F)
  2. Chtanova T, et al. 2008. Immunity 29:487.
  3. Klass M, et al. 2012. J. Immunol. 189:2414. PubMed
RRID
AB_2783106 (BioLegend Cat. No. 142425)

Antigen Details

Structure
Type I single membrane-spanning lectin containing 17 immunoglobulin (Ig) domains, belongs to the immunoglobulin superfamily.
Distribution

Macrophages in spleen, lymph nodes, bone marrow, liver, colon and lungs.

Function
Adhesion.
Ligand Receptor
PSGL-1, CD43, CD206 and CD227.
Cell Type
Macrophages
Biology Area
Cell Biology, Immunology
Molecular Family
Adhesion Molecules, CD Molecules, Protein Kinases/Phosphatase, Siglec Molecules
Antigen References

1. Chow A, et al. 2011. J. Exp. Med. 208:261.
2. Asano K, et al. 2011. Immunity 34:85.
3. Xiong YS, et al. 2009. Clin. Biochem. 42:1057.
4. Varki A, et al. 2009. Glycoconj. J. 26:231.
5. Rempel H, et al. 2008. PLoS One 3:e1967.
6. Crocker PR, et al. 2001. Trends Immunol. 22:337.
7. Hartnell A, et al. 2001. Blood 97:288.
8. Crocker PR, et al. 1985. J. Exp. Med. 162:993.

Gene ID
20612 View all products for this Gene ID
UniProt
View information about CD169 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 10/15/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account